Morpholino

MO3-fgf10a

ID
ZDB-MRPHLNO-081021-3
Name
MO3-fgf10a
Previous Names
None
Target
Sequence
5' - GCTTTACTCACTGTACGGATCGTCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-fgf10a
No data available
Phenotype
Phenotype resulting from MO3-fgf10a
Phenotype Fish Figures
dorsal aorta runx1 expression increased amount, abnormal AB + MO3-fgf10a Fig. 2 from Pouget et al., 2014
dorsal aorta myb expression increased amount, abnormal AB + MO3-fgf10a Fig. 2 from Pouget et al., 2014
dorsal aorta runx1 expression mislocalised, abnormal AB + MO3-fgf10a Fig. 2 from Pouget et al., 2014
dorsal aorta myb expression mislocalised, abnormal AB + MO3-fgf10a Fig. 2 from Pouget et al., 2014
ectodermal placode development decreased process quality, abnormal AB + MO3-fgf10a Fig. 2 with image from McCarroll et al., 2013
ethmoid cartilage decreased length, abnormal AB + MO3-fgf10a Fig. 8 with image from Swartz et al., 2011
facial placode poorly differentiated, abnormal AB + MO3-fgf10a Fig. 2 with image from McCarroll et al., 2013
glossopharyngeal placode poorly differentiated, abnormal AB + MO3-fgf10a Fig. 2 with image from McCarroll et al., 2013
mandibular arch skeleton decreased length, abnormal AB + MO3-fgf10a Fig. 8 with image from Swartz et al., 2011
mandibular arch skeleton shape, abnormal AB + MO3-fgf10a Fig. 8 with image from Swartz et al., 2011
Meckel's cartilage shape, abnormal AB + MO3-fgf10a Fig. 8 with image from Swartz et al., 2011
palate shape, abnormal AB + MO3-fgf10a Fig. 8 with image from Swartz et al., 2011
palate square, abnormal AB + MO3-fgf10a Fig. 8 with image from Swartz et al., 2011
palatoquadrate cartilage shape, abnormal AB + MO3-fgf10a Fig. 8 with image from Swartz et al., 2011
parasphenoid decreased length, abnormal AB + MO3-fgf10a Fig. 8 with image from Swartz et al., 2011
parasphenoid shape, abnormal AB + MO3-fgf10a Fig. 8 with image from Swartz et al., 2011
pectoral fin aplastic, abnormal AB + MO3-fgf10a Fig. S5 from Nechiporuk et al., 2008
trabecula cranii decreased length, abnormal AB + MO3-fgf10a Fig. 8 with image from Swartz et al., 2011
trabecula cranii shape, abnormal AB + MO3-fgf10a Fig. 8 with image from Swartz et al., 2011
trunk myb expression increased amount, abnormal AB + MO3-fgf10a Fig. 2 from Pouget et al., 2014
trunk runx1 expression increased amount, abnormal AB + MO3-fgf10a Fig. 2 from Pouget et al., 2014
vagal placode 1 poorly differentiated, abnormal AB + MO3-fgf10a Fig. 2 with image from McCarroll et al., 2013
vagal placode 2 poorly differentiated, abnormal AB + MO3-fgf10a Fig. 2 with image from McCarroll et al., 2013
vagal placode 3 poorly differentiated, abnormal AB + MO3-fgf10a Fig. 2 with image from McCarroll et al., 2013
vagal placode 4 poorly differentiated, abnormal AB + MO3-fgf10a Fig. 2 with image from McCarroll et al., 2013
vagal placode 4 neuroblast (sensu Vertebrata) mislocalised ventrally, abnormal nl6Tg + MO3-fgf10a Fig. 5 with image from McCarroll et al., 2013
ventral wall of dorsal aorta myb expression increased amount, abnormal AB + MO3-fgf10a Fig. 2 from Pouget et al., 2014
ventral wall of dorsal aorta runx1 expression increased amount, abnormal AB + MO3-fgf10a Fig. 2 from Pouget et al., 2014
Phenotype of all Fish created by or utilizing MO3-fgf10a
Phenotype Fish Conditions Figures
vagal placode 3 poorly differentiated, abnormal AB + MO3-fgf10a standard conditions Fig. 2 with image from McCarroll et al., 2013
ventral wall of dorsal aorta runx1 expression increased amount, abnormal AB + MO3-fgf10a standard conditions Fig. 2 from Pouget et al., 2014
parasphenoid decreased length, abnormal AB + MO3-fgf10a standard conditions Fig. 8 with image from Swartz et al., 2011
trunk myb expression increased amount, abnormal AB + MO3-fgf10a standard conditions Fig. 2 from Pouget et al., 2014
vagal placode 4 poorly differentiated, abnormal AB + MO3-fgf10a standard conditions Fig. 2 with image from McCarroll et al., 2013
trunk runx1 expression increased amount, abnormal AB + MO3-fgf10a standard conditions Fig. 2 from Pouget et al., 2014
palatoquadrate cartilage shape, abnormal AB + MO3-fgf10a standard conditions Fig. 8 with image from Swartz et al., 2011
trabecula cranii shape, abnormal AB + MO3-fgf10a standard conditions Fig. 8 with image from Swartz et al., 2011
ventral wall of dorsal aorta myb expression increased amount, abnormal AB + MO3-fgf10a standard conditions Fig. 2 from Pouget et al., 2014
dorsal aorta runx1 expression mislocalised, abnormal AB + MO3-fgf10a standard conditions Fig. 2 from Pouget et al., 2014
ethmoid cartilage decreased length, abnormal AB + MO3-fgf10a standard conditions Fig. 8 with image from Swartz et al., 2011
dorsal aorta myb expression mislocalised, abnormal AB + MO3-fgf10a standard conditions Fig. 2 from Pouget et al., 2014
mandibular arch skeleton decreased length, abnormal AB + MO3-fgf10a standard conditions Fig. 8 with image from Swartz et al., 2011
dorsal aorta runx1 expression increased amount, abnormal AB + MO3-fgf10a standard conditions Fig. 2 from Pouget et al., 2014
palate square, abnormal AB + MO3-fgf10a standard conditions Fig. 8 with image from Swartz et al., 2011
trabecula cranii decreased length, abnormal AB + MO3-fgf10a standard conditions Fig. 8 with image from Swartz et al., 2011
ectodermal placode development decreased process quality, abnormal AB + MO3-fgf10a standard conditions Fig. 2 with image from McCarroll et al., 2013
vagal placode 1 poorly differentiated, abnormal AB + MO3-fgf10a standard conditions Fig. 2 with image from McCarroll et al., 2013
glossopharyngeal placode poorly differentiated, abnormal AB + MO3-fgf10a standard conditions Fig. 2 with image from McCarroll et al., 2013
dorsal aorta myb expression increased amount, abnormal AB + MO3-fgf10a standard conditions Fig. 2 from Pouget et al., 2014
facial placode poorly differentiated, abnormal AB + MO3-fgf10a standard conditions Fig. 2 with image from McCarroll et al., 2013
vagal placode 2 poorly differentiated, abnormal AB + MO3-fgf10a standard conditions Fig. 2 with image from McCarroll et al., 2013
pectoral fin aplastic, abnormal AB + MO3-fgf10a standard conditions Fig. S5 from Nechiporuk et al., 2008
Meckel's cartilage shape, abnormal AB + MO3-fgf10a standard conditions Fig. 8 with image from Swartz et al., 2011
palate shape, abnormal AB + MO3-fgf10a standard conditions Fig. 8 with image from Swartz et al., 2011
mandibular arch skeleton shape, abnormal AB + MO3-fgf10a standard conditions Fig. 8 with image from Swartz et al., 2011
parasphenoid shape, abnormal AB + MO3-fgf10a standard conditions Fig. 8 with image from Swartz et al., 2011
vagal placode 4 neuroblast (sensu Vertebrata) mislocalised ventrally, abnormal nl6Tg + MO3-fgf10a standard conditions Fig. 5 with image from McCarroll et al., 2013
vagal placode 2 poorly differentiated, abnormal fgf3t26212/+ + MO3-fgf10a standard conditions Fig. 2 with image from McCarroll et al., 2013
vagal placode 3 poorly differentiated, abnormal fgf3t26212/+ + MO3-fgf10a standard conditions Fig. 2 with image from McCarroll et al., 2013
glossopharyngeal placode poorly differentiated, abnormal fgf3t26212/+ + MO3-fgf10a standard conditions Fig. 2 with image from McCarroll et al., 2013
facial placode poorly differentiated, abnormal fgf3t26212/+ + MO3-fgf10a standard conditions Fig. 2 with image from McCarroll et al., 2013
vagal placode 4 poorly differentiated, abnormal fgf3t26212/+ + MO3-fgf10a standard conditions Fig. 2 with image from McCarroll et al., 2013
ectodermal placode development decreased process quality, abnormal fgf3t26212/+ + MO3-fgf10a standard conditions Fig. 2 with image from McCarroll et al., 2013
vagal placode 1 poorly differentiated, abnormal fgf3t26212/+ + MO3-fgf10a standard conditions Fig. 2 with image from McCarroll et al., 2013
vagal placode 3 poorly differentiated, abnormal fgf3t26212/t26212 + MO3-fgf10a standard conditions Fig. 2 with image from McCarroll et al., 2013
head lacks all parts of type facial placode, abnormal fgf3t26212/t26212 + MO3-fgf10a standard conditions Fig. 2 with image from McCarroll et al., 2013
vagal placode 4 poorly differentiated, abnormal fgf3t26212/t26212 + MO3-fgf10a standard conditions Fig. 2 with image from McCarroll et al., 2013
anterior lateral line development decreased process quality, abnormal fgf3t26212/t26212 + MO3-fgf10a standard conditions Fig. 4 with image from McCarroll et al., 2013
glossopharyngeal placode poorly differentiated, abnormal fgf3t26212/t26212 + MO3-fgf10a standard conditions Fig. 2 with image from McCarroll et al., 2013
vagal placode 1 poorly differentiated, abnormal fgf3t26212/t26212 + MO3-fgf10a standard conditions Fig. 2 with image from McCarroll et al., 2013
anterior lateral line decreased object quality, abnormal fgf3t26212/t26212 + MO3-fgf10a standard conditions Fig. 4 with image from McCarroll et al., 2013
vagal placode 2 poorly differentiated, abnormal fgf3t26212/t26212 + MO3-fgf10a standard conditions Fig. 2 with image from McCarroll et al., 2013
ectodermal placode development decreased process quality, abnormal fgf3t26212/t26212 + MO3-fgf10a standard conditions Fig. 2 with image from McCarroll et al., 2013
ectodermal placode development decreased process quality, abnormal AB + MO1-sox32 + MO3-fgf10a standard conditions Fig. 3 with image from McCarroll et al., 2013
vagal placode 1 poorly differentiated, abnormal AB + MO1-sox32 + MO3-fgf10a standard conditions Fig. 3 with image from McCarroll et al., 2013
glossopharyngeal placode poorly differentiated, abnormal AB + MO1-sox32 + MO3-fgf10a standard conditions Fig. 3 with image from McCarroll et al., 2013
vagal placode 2 poorly differentiated, abnormal AB + MO1-sox32 + MO3-fgf10a standard conditions Fig. 3 with image from McCarroll et al., 2013
facial placode poorly differentiated, abnormal AB + MO1-sox32 + MO3-fgf10a standard conditions Fig. 3 with image from McCarroll et al., 2013
vagal placode 3 poorly differentiated, abnormal AB + MO1-sox32 + MO3-fgf10a standard conditions Fig. 3 with image from McCarroll et al., 2013
vagal placode 4 poorly differentiated, abnormal AB + MO1-sox32 + MO3-fgf10a standard conditions Fig. 3 with image from McCarroll et al., 2013
head lacks all parts of type facial ganglion, abnormal w37Tg + MO1-sox32 + MO3-fgf10a standard conditions Fig. 3 with image from McCarroll et al., 2013
head lacks all parts of type glossopharyngeal ganglion, abnormal w37Tg + MO1-sox32 + MO3-fgf10a standard conditions Fig. 3 with image from McCarroll et al., 2013
head lacks all parts of type vagal ganglion 1, abnormal w37Tg + MO1-sox32 + MO3-fgf10a standard conditions Fig. 3 with image from McCarroll et al., 2013
head lacks all parts of type vagal ganglion 2, abnormal w37Tg + MO1-sox32 + MO3-fgf10a standard conditions Fig. 3 with image from McCarroll et al., 2013
head lacks all parts of type vagal ganglion 4, abnormal w37Tg + MO1-sox32 + MO3-fgf10a standard conditions Fig. 3 with image from McCarroll et al., 2013
head lacks all parts of type vagal ganglion 3, abnormal w37Tg + MO1-sox32 + MO3-fgf10a standard conditions Fig. 3 with image from McCarroll et al., 2013
cranial ganglion maturation decreased process quality, abnormal w37Tg + MO1-sox32 + MO3-fgf10a standard conditions Fig. 3 with image from McCarroll et al., 2013
vagal placode 4 neuroblast (sensu Vertebrata) mislocalised ventrally, abnormal fgf3t26212/+; nl6Tg + MO3-fgf10a standard conditions Fig. 5 with image from McCarroll et al., 2013
vagal placode 3 neurogenesis decreased occurrence, abnormal fgf3t26212/t26212; nl6Tg + MO3-fgf10a standard conditions Fig. 5 with image from McCarroll et al., 2013
facial placode neurogenesis decreased occurrence, abnormal fgf3t26212/t26212; nl6Tg + MO3-fgf10a standard conditions Fig. 5 with image from McCarroll et al., 2013
vagal placode 1 neurogenesis decreased occurrence, abnormal fgf3t26212/t26212; nl6Tg + MO3-fgf10a standard conditions Fig. 5 with image from McCarroll et al., 2013
vagal placode 2 neurogenesis decreased occurrence, abnormal fgf3t26212/t26212; nl6Tg + MO3-fgf10a standard conditions Fig. 5 with image from McCarroll et al., 2013
vagal placode 4 neurogenesis decreased occurrence, abnormal fgf3t26212/t26212; nl6Tg + MO3-fgf10a standard conditions Fig. 5 with image from McCarroll et al., 2013
glossopharyngeal placode neurogenesis decreased occurrence, abnormal fgf3t26212/t26212; nl6Tg + MO3-fgf10a standard conditions Fig. 5 with image from McCarroll et al., 2013
ectodermal placode development decreased process quality, abnormal fgf3t26212/t26212; w37Tg + MO3-fgf10a standard conditions Fig. 2 with image from McCarroll et al., 2013
head lacks all parts of type vagal ganglion 1, abnormal fgf3t26212/t26212; w37Tg + MO3-fgf10a standard conditions Fig. 2 with image from McCarroll et al., 2013
head lacks all parts of type vagal ganglion 3, abnormal fgf3t26212/t26212; w37Tg + MO3-fgf10a standard conditions Fig. 2 with image from McCarroll et al., 2013
head lacks all parts of type glossopharyngeal ganglion, abnormal fgf3t26212/t26212; w37Tg + MO3-fgf10a standard conditions Fig. 2 with image from McCarroll et al., 2013
head lacks all parts of type facial ganglion, abnormal fgf3t26212/t26212; w37Tg + MO3-fgf10a standard conditions Fig. 2 with image from McCarroll et al., 2013
head lacks all parts of type vagal ganglion 2, abnormal fgf3t26212/t26212; w37Tg + MO3-fgf10a standard conditions Fig. 2 with image from McCarroll et al., 2013
head lacks all parts of type vagal ganglion 4, abnormal fgf3t26212/t26212; w37Tg + MO3-fgf10a standard conditions Fig. 2 with image from McCarroll et al., 2013
Citations