Morpholino

MO7-sox18

ID
ZDB-MRPHLNO-081022-6
Name
MO7-sox18
Previous Names
  • sox18-MO2 (1)
Target
Sequence
5' - GTGAGTGTCTTACCCAGCATTTTAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
binds to intron splice site
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO7-sox18
No data available
Phenotype
Phenotype resulting from MO7-sox18
Phenotype of all Fish created by or utilizing MO7-sox18
Phenotype Fish Conditions Figures
thoracic duct morphology, abnormal y1Tg + MO7-sox18 standard conditions Fig. 1 from Cermenati et al., 2013
posterior cardinal vein vascular lymphangioblast absent, abnormal y1Tg + MO7-sox18 standard conditions Fig. 6 from Cermenati et al., 2013
posterior cardinal vein vascular sprouts decreased amount, abnormal y1Tg + MO7-sox18 standard conditions Fig. 2 from Cermenati et al., 2013
vascular lymphangioblast decreased amount, abnormal y1Tg + MO7-sox18 standard conditions Fig. 2 from Cermenati et al., 2013
posterior cardinal vein vascular lymphangioblast decreased amount, abnormal y1Tg + MO7-sox18 standard conditions Fig. 6 from Cermenati et al., 2013
thoracic duct aplastic/hypoplastic, abnormal y1Tg + MO7-sox18 standard conditions Fig. 1 from Cermenati et al., 2013
thoracic duct hypoplastic, abnormal y171Tg; y251Tg + MO7-sox18 standard conditions Figure S2 from Moleri et al., 2023
thoracic duct malformed, abnormal y171Tg; y251Tg + MO7-sox18 standard conditions Figure S2 from Moleri et al., 2023
lymphangiogenesis disrupted, abnormal y171Tg; y251Tg + MO7-sox18 standard conditions Figure S2 from Moleri et al., 2023
thoracic duct decreased amount, abnormal y171Tg; y251Tg + MO7-sox18 standard conditions Figure S2 from Moleri et al., 2023
horizontal myoseptum vascular lymphangioblast decreased amount, abnormal y1Tg + MO2-vegfc + MO7-sox18 standard conditions Fig. 5 from Cermenati et al., 2013
posterior cardinal vein intersegmental vein decreased amount, abnormal y1Tg + MO2-vegfc + MO7-sox18 standard conditions Fig. 5 from Cermenati et al., 2013
posterior cardinal vein vascular sprouts decreased amount, abnormal y1Tg + MO2-vegfc + MO7-sox18 standard conditions Fig. 5 from Cermenati et al., 2013
thoracic duct aplastic, abnormal y1Tg + MO2-vegfc + MO7-sox18 standard conditions Fig. 4 from Cermenati et al., 2013
trunk intersegmental vein decreased amount, abnormal y1Tg + MO2-vegfc + MO7-sox18 standard conditions Fig. 5 from Cermenati et al., 2013
posterior cardinal vein vascular lymphangioblast decreased amount, abnormal y1Tg + MO2-vegfc + MO7-sox18 standard conditions Fig. 5Fig. 6 from Cermenati et al., 2013
posterior cardinal vein vascular lymphangioblast absent, abnormal y1Tg + MO2-vegfc + MO7-sox18 standard conditions Fig. 6 from Cermenati et al., 2013
Citations