Morpholino

MO7-sox18

ID

ZDB-MRPHLNO-081022-6

Name

MO7-sox18

Previous Names

sox18-MO2 (1)

Target

sox18 (1)

Sequence

5' - GTGAGTGTCTTACCCAGCATTTTAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

binds to intron splice site

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO7-sox18

No data available

Phenotype

Phenotype resulting from MO7-sox18

Phenotype	Fish	Figures
lymphangiogenesis disrupted, abnormal	y171Tg; y251Tg + MO7-sox18	Figure S2 from Moleri et al., 2023
posterior cardinal vein vascular lymphangioblast absent, abnormal	y1Tg + MO7-sox18	Fig. 6 from Cermenati et al., 2013
posterior cardinal vein vascular lymphangioblast decreased amount, abnormal	y1Tg + MO7-sox18	Fig. 6 from Cermenati et al., 2013
posterior cardinal vein vascular sprouts decreased amount, abnormal	y1Tg + MO7-sox18	Fig. 2 from Cermenati et al., 2013
thoracic duct aplastic/hypoplastic, abnormal	y1Tg + MO7-sox18	Fig. 1 from Cermenati et al., 2013
thoracic duct decreased amount, abnormal	y171Tg; y251Tg + MO7-sox18	Figure S2 from Moleri et al., 2023
thoracic duct hypoplastic, abnormal	y171Tg; y251Tg + MO7-sox18	Figure S2 from Moleri et al., 2023
thoracic duct malformed, abnormal	y171Tg; y251Tg + MO7-sox18	Figure S2 from Moleri et al., 2023
thoracic duct morphology, abnormal	y1Tg + MO7-sox18	Fig. 1 from Cermenati et al., 2013
vascular lymphangioblast decreased amount, abnormal	y1Tg + MO7-sox18	Fig. 2 from Cermenati et al., 2013

Phenotype of all Fish created by or utilizing MO7-sox18

Phenotype	Fish	Conditions	Figures
thoracic duct morphology, abnormal	y1Tg + MO7-sox18	standard conditions	Fig. 1 from Cermenati et al., 2013
posterior cardinal vein vascular lymphangioblast absent, abnormal	y1Tg + MO7-sox18	standard conditions	Fig. 6 from Cermenati et al., 2013
posterior cardinal vein vascular sprouts decreased amount, abnormal	y1Tg + MO7-sox18	standard conditions	Fig. 2 from Cermenati et al., 2013
vascular lymphangioblast decreased amount, abnormal	y1Tg + MO7-sox18	standard conditions	Fig. 2 from Cermenati et al., 2013
posterior cardinal vein vascular lymphangioblast decreased amount, abnormal	y1Tg + MO7-sox18	standard conditions	Fig. 6 from Cermenati et al., 2013
thoracic duct aplastic/hypoplastic, abnormal	y1Tg + MO7-sox18	standard conditions	Fig. 1 from Cermenati et al., 2013
thoracic duct hypoplastic, abnormal	y171Tg; y251Tg + MO7-sox18	standard conditions	Figure S2 from Moleri et al., 2023
thoracic duct malformed, abnormal	y171Tg; y251Tg + MO7-sox18	standard conditions	Figure S2 from Moleri et al., 2023
lymphangiogenesis disrupted, abnormal	y171Tg; y251Tg + MO7-sox18	standard conditions	Figure S2 from Moleri et al., 2023
thoracic duct decreased amount, abnormal	y171Tg; y251Tg + MO7-sox18	standard conditions	Figure S2 from Moleri et al., 2023
horizontal myoseptum vascular lymphangioblast decreased amount, abnormal	y1Tg + MO2-vegfc + MO7-sox18	standard conditions	Fig. 5 from Cermenati et al., 2013
posterior cardinal vein intersegmental vein decreased amount, abnormal	y1Tg + MO2-vegfc + MO7-sox18	standard conditions	Fig. 5 from Cermenati et al., 2013
posterior cardinal vein vascular sprouts decreased amount, abnormal	y1Tg + MO2-vegfc + MO7-sox18	standard conditions	Fig. 5 from Cermenati et al., 2013
thoracic duct aplastic, abnormal	y1Tg + MO2-vegfc + MO7-sox18	standard conditions	Fig. 4 from Cermenati et al., 2013
trunk intersegmental vein decreased amount, abnormal	y1Tg + MO2-vegfc + MO7-sox18	standard conditions	Fig. 5 from Cermenati et al., 2013
posterior cardinal vein vascular lymphangioblast decreased amount, abnormal	y1Tg + MO2-vegfc + MO7-sox18	standard conditions	Fig. 5, Fig. 6 from Cermenati et al., 2013
posterior cardinal vein vascular lymphangioblast absent, abnormal	y1Tg + MO2-vegfc + MO7-sox18	standard conditions	Fig. 6 from Cermenati et al., 2013

Citations