Morpholino

MO1-ofd1

ID
ZDB-MRPHLNO-090312-2
Name
MO1-ofd1
Previous Names
  • ofd1 SPL6 MO (1)
Target
Sequence
5' - ATCTTCTCTACTGCAACACACATAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ofd1
No data available
Phenotype
Phenotype resulting from MO1-ofd1
Phenotype Fish Figures
brain hydrocephalic, abnormal WT + MO1-ofd1 Fig. 2 from Ferrante et al., 2009
convergent extension disrupted, abnormal WT + MO1-ofd1 Fig. 5 from Liu et al., 2014
Fig. 6 from Ferrante et al., 2009
determination of heart left/right asymmetry disrupted, abnormal WT + MO1-ofd1 Fig. 7 from Lopes et al., 2011
determination of left/right symmetry disrupted, abnormal WT + MO1-ofd1 Fig. 4 from Ferrante et al., 2009
glomerular filtration disrupted, abnormal WT + MO1-ofd1 Fig. 3 from Ferrante et al., 2009
heart looping process quality, abnormal WT + MO1-ofd1 Fig. 4 from Ferrante et al., 2009
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-ofd1 Fig. 5 from Ferrante et al., 2009
Kupffer's vesicle cilium movement quality, abnormal WT + MO1-ofd1 Fig. 5 from Ferrante et al., 2009
Meckel's cartilage morphology, abnormal WT + MO1-ofd1 Fig. 2 from Ferrante et al., 2009
optic fissure closure incomplete, abnormal WT + MO1-ofd1 Fig. 2 from Ferrante et al., 2009
optic fissure unfused from optic fissure, abnormal WT + MO1-ofd1 Fig. 2 from Ferrante et al., 2009
otolith decreased size, abnormal WT + MO1-ofd1 Fig. 2 from Ferrante et al., 2009
otolith increased amount, abnormal WT + MO1-ofd1 Fig. 2 from Ferrante et al., 2009
pericardium edematous, abnormal WT + MO1-ofd1 Fig. 2 from Ferrante et al., 2009
pronephric glomerulus morphology, abnormal WT + MO1-ofd1 Fig. 3 from Ferrante et al., 2009
pronephric glomerulus unfused from pronephric glomerulus, abnormal WT + MO1-ofd1 Fig. 3Fig. 6 from Ferrante et al., 2009
somite increased width, abnormal WT + MO1-ofd1 Fig. 5 from Liu et al., 2014
somite border amorphous, abnormal WT + MO1-ofd1 Fig. 5 from Liu et al., 2014
ventricular system dilated, abnormal WT + MO1-ofd1 Fig. 2 from Ferrante et al., 2009
whole organism decreased length, abnormal WT + MO1-ofd1 Fig. 6 from Ferrante et al., 2009
whole organism edematous, abnormal WT + MO1-ofd1 Fig. 2 from Ferrante et al., 2009
whole organism increased curvature, abnormal WT + MO1-ofd1 Fig. 2 from Ferrante et al., 2009
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-ofd1 Fig. 5 from Liu et al., 2014
Phenotype of all Fish created by or utilizing MO1-ofd1
Phenotype Fish Conditions Figures
whole organism decreased length, abnormal WT + MO1-ofd1 standard conditions Fig. 6 from Ferrante et al., 2009
whole organism edematous, abnormal WT + MO1-ofd1 standard conditions Fig. 2 from Ferrante et al., 2009
otolith decreased size, abnormal WT + MO1-ofd1 standard conditions Fig. 2 from Ferrante et al., 2009
convergent extension disrupted, abnormal WT + MO1-ofd1 standard conditions Fig. 5 from Liu et al., 2014
Fig. 6 from Ferrante et al., 2009
heart looping process quality, abnormal WT + MO1-ofd1 standard conditions Fig. 4 from Ferrante et al., 2009
determination of left/right symmetry disrupted, abnormal WT + MO1-ofd1 standard conditions Fig. 4 from Ferrante et al., 2009
pronephric glomerulus unfused from pronephric glomerulus, abnormal WT + MO1-ofd1 standard conditions Fig. 3Fig. 6 from Ferrante et al., 2009
optic fissure unfused from optic fissure, abnormal WT + MO1-ofd1 standard conditions Fig. 2 from Ferrante et al., 2009
Meckel's cartilage morphology, abnormal WT + MO1-ofd1 standard conditions Fig. 2 from Ferrante et al., 2009
somite increased width, abnormal WT + MO1-ofd1 standard conditions Fig. 5 from Liu et al., 2014
somite border amorphous, abnormal WT + MO1-ofd1 standard conditions Fig. 5 from Liu et al., 2014
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-ofd1 standard conditions Fig. 5 from Ferrante et al., 2009
brain hydrocephalic, abnormal WT + MO1-ofd1 standard conditions Fig. 2 from Ferrante et al., 2009
Kupffer's vesicle cilium movement quality, abnormal WT + MO1-ofd1 standard conditions Fig. 5 from Ferrante et al., 2009
pericardium edematous, abnormal WT + MO1-ofd1 standard conditions Fig. 2 from Ferrante et al., 2009
determination of heart left/right asymmetry disrupted, abnormal WT + MO1-ofd1 standard conditions Fig. 7 from Lopes et al., 2011
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-ofd1 standard conditions Fig. 5 from Liu et al., 2014
ventricular system dilated, abnormal WT + MO1-ofd1 standard conditions Fig. 2 from Ferrante et al., 2009
optic fissure closure incomplete, abnormal WT + MO1-ofd1 standard conditions Fig. 2 from Ferrante et al., 2009
glomerular filtration disrupted, abnormal WT + MO1-ofd1 standard conditions Fig. 3 from Ferrante et al., 2009
pronephric glomerulus morphology, abnormal WT + MO1-ofd1 standard conditions Fig. 3 from Ferrante et al., 2009
whole organism increased curvature, abnormal WT + MO1-ofd1 standard conditions Fig. 2 from Ferrante et al., 2009
otolith increased amount, abnormal WT + MO1-ofd1 standard conditions Fig. 2 from Ferrante et al., 2009
pronephric glomerulus unfused from pronephric glomerulus, abnormal vangl2m209/m209 + MO1-ofd1 standard conditions Fig. 6 from Ferrante et al., 2009
determination of heart left/right asymmetry disrupted, abnormal WT + MO1-bbs4 + MO1-ofd1 standard conditions Fig. 7 from Lopes et al., 2011
whole organism increased curvature, abnormal WT + MO1-bbs4 + MO1-ofd1 standard conditions Fig. 7 from Lopes et al., 2011
neural plate increased width, abnormal WT + MO1-ofd1 + MO1-vangl2 standard conditions Fig. 6 from Ferrante et al., 2009
whole organism decreased length, abnormal WT + MO1-ofd1 + MO1-vangl2 standard conditions Fig. 6 from Ferrante et al., 2009
convergent extension disrupted, abnormal WT + MO1-ofd1 + MO1-wnt11f2 standard conditions Fig. 6 from Ferrante et al., 2009
Citations