Morpholino

MO2-foxj1a

ID
ZDB-MRPHLNO-090409-2
Name
MO2-foxj1a
Previous Names
None
Target
Sequence
5' - CATGGAACTCATGGAGAGCATGGTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
translation inhibitory morpholino
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-foxj1a
No data available
Phenotype
Phenotype resulting from MO2-foxj1a
Phenotype Fish Figures
determination of heart left/right asymmetry disrupted, abnormal WT + MO2-foxj1a Fig. 4 with image from Dutta et al., 2015
determination of left/right symmetry arrested, abnormal WT + MO2-foxj1a Fig. S3 from Yu et al., 2008
determination of left/right symmetry disrupted, abnormal WT + MO2-foxj1a Fig. 4 with image from Dutta et al., 2015
floor plate cilium decreased amount, abnormal WT + MO2-foxj1a Fig. 2 from Yu et al., 2008
forerunner cell group cirop expression absent, abnormal AB + MO2-foxj1a Fig. 2 from Szenker-Ravi et al., 2021
forerunner cell group foxj1a expression absent, abnormal AB + MO2-foxj1a Fig. 2 from Szenker-Ravi et al., 2021
heart bilateral symmetry, abnormal WT + MO2-foxj1a Fig. S3 from Yu et al., 2008
heart looping disrupted, abnormal WT + MO2-foxj1a Fig. S3 from Yu et al., 2008
Kupffer's vesicle znf703 expression decreased distribution, abnormal WT + MO2-foxj1a Fig. 4 with image from Dutta et al., 2015
Kupffer's vesicle cilium absent, abnormal WT + MO2-foxj1a Fig. 2 from Yu et al., 2008
Kupffer's vesicle motile cilium absent, abnormal WT + MO2-foxj1a Fig. 4 with image from Dutta et al., 2015
Kupffer's vesicle motile cilium decreased amount, abnormal WT + MO2-foxj1a Fig. 3 with image from Dutta et al., 2015
pronephric duct cilium decreased amount, abnormal WT + MO2-foxj1a Fig. 2 from Yu et al., 2008
pronephric duct motile cilium decreased length, abnormal WT + MO2-foxj1a Fig. 5 with image from Lu et al., 2015
whole organism posterior region znf703 expression decreased distribution, abnormal WT + MO2-foxj1a Fig. 4 with image from Dutta et al., 2015
Phenotype of all Fish created by or utilizing MO2-foxj1a
Phenotype Fish Conditions Figures
forerunner cell group cirop expression absent, abnormal AB + MO2-foxj1a standard conditions Fig. 2 from Szenker-Ravi et al., 2021
forerunner cell group foxj1a expression absent, abnormal AB + MO2-foxj1a standard conditions Fig. 2 from Szenker-Ravi et al., 2021
Kupffer's vesicle znf703 expression amount, ameliorated WT + MO2-foxj1a chemical treatment: lithium chloride Fig. 4 with image from Dutta et al., 2015
Kupffer's vesicle motile cilium absent, abnormal WT + MO2-foxj1a standard conditions Fig. 4 with image from Dutta et al., 2015
heart looping disrupted, abnormal WT + MO2-foxj1a standard conditions Fig. S3 from Yu et al., 2008
whole organism posterior region znf703 expression amount, ameliorated WT + MO2-foxj1a chemical treatment: lithium chloride Fig. 4 with image from Dutta et al., 2015
pronephric duct cilium decreased amount, abnormal WT + MO2-foxj1a standard conditions Fig. 2 from Yu et al., 2008
whole organism posterior region znf703 expression decreased distribution, abnormal WT + MO2-foxj1a standard conditions Fig. 4 with image from Dutta et al., 2015
floor plate cilium decreased amount, abnormal WT + MO2-foxj1a standard conditions Fig. 2 from Yu et al., 2008
determination of left/right symmetry disrupted, abnormal WT + MO2-foxj1a standard conditions Fig. 4 with image from Dutta et al., 2015
Kupffer's vesicle motile cilium decreased amount, abnormal WT + MO2-foxj1a standard conditions Fig. 3 with image from Dutta et al., 2015
Kupffer's vesicle znf703 expression decreased distribution, abnormal WT + MO2-foxj1a standard conditions Fig. 4 with image from Dutta et al., 2015
pronephric duct motile cilium decreased length, abnormal WT + MO2-foxj1a standard conditions Fig. 5 with image from Lu et al., 2015
determination of left/right symmetry arrested, abnormal WT + MO2-foxj1a standard conditions Fig. S3 from Yu et al., 2008
determination of heart left/right asymmetry disrupted, abnormal WT + MO2-foxj1a standard conditions Fig. 4 with image from Dutta et al., 2015
heart bilateral symmetry, abnormal WT + MO2-foxj1a standard conditions Fig. S3 from Yu et al., 2008
Kupffer's vesicle cilium absent, abnormal WT + MO2-foxj1a standard conditions Fig. 2 from Yu et al., 2008
Citations