Morpholino

MO1-tert

ID
ZDB-MRPHLNO-090505-1
Name
MO1-tert
Previous Names
None
Target
Sequence
5' - CTGTCGAGTACTGTCCAGACATCTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tert
No data available
Phenotype
Phenotype resulting from MO1-tert
Phenotype of all Fish created by or utilizing MO1-tert
Phenotype Fish Conditions Figures
trunk apoptotic, abnormal WT + MO1-tert standard conditions Fig. 2 with image from Imamura et al., 2008
telomerase activity process characteristic, abnormal WT + MO1-tert standard conditions Fig. 1 with image from Imamura et al., 2008
blood cell absent, abnormal WT + MO1-tert standard conditions Fig. 2 with image,  Fig. 5 with image from Imamura et al., 2008
caudal vein plexus apoptotic, abnormal WT + MO1-tert standard conditions Fig. 2 with image,  Fig. 5 with image from Imamura et al., 2008
blood cell decreased amount, abnormal WT + MO1-tert standard conditions Fig. 2 with image,  text only from Imamura et al., 2008
nucleate erythrocyte decreased amount, abnormal WT + MO1-tert standard conditions Fig. 2 with image from Imamura et al., 2008
head apoptotic, abnormal WT + MO1-tert standard conditions Fig. 2 with image from Imamura et al., 2008
whole organism hypoplastic, abnormal WT + MO1-tert standard conditions text only from Imamura et al., 2008
ventral wall of dorsal aorta apoptotic, abnormal WT + MO1-tert standard conditions Fig. 2 with image from Imamura et al., 2008
blood cell apoptotic, abnormal WT + MO1-tert standard conditions Fig. 2 with image from Imamura et al., 2008
heme biosynthetic process disrupted, abnormal WT + MO1-tert standard conditions Fig. 3 with image from Imamura et al., 2008
blood cell decreased amount, abnormal WT + MO1-tert + MO4-tp53 standard conditions Fig. 5 with image from Imamura et al., 2008
nucleate erythrocyte decreased amount, abnormal la781Tg + MO1-tert standard conditions Fig. 4 with image from Imamura et al., 2008
caudal vein plexus apoptotic, abnormal la781Tg + MO1-tert standard conditions Fig. 2 with image from Imamura et al., 2008
telomerase activity process characteristic, abnormal la781Tg + MO1-tert standard conditions Fig. 4 with image from Imamura et al., 2008
nucleate erythrocyte immature, abnormal la781Tg + MO1-tert standard conditions Fig. 4 with image from Imamura et al., 2008
blood cell apoptotic, abnormal la781Tg + MO1-tert standard conditions Fig. 2 with image from Imamura et al., 2008
blood cell decreased amount, abnormal tp53zdf1/zdf1 + MO1-tert standard conditions text only from Imamura et al., 2008
Citations