Morpholino

MO1-igf2a

ID
ZDB-MRPHLNO-090929-1
Name
MO1-igf2a
Previous Names
  • 2aMO1 (1)
Target
Sequence
5' - CACAGAATACATGGTAATCATCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-igf2a
No data available
Phenotype
Phenotype resulting from MO1-igf2a
Phenotype Fish Figures
angiogenesis disrupted, abnormal y1Tg + MO1-igf2a text only from Hartnett et al., 2010
apoptotic process increased occurrence, abnormal AB + MO1-igf2a Fig. S4 with image from Hartnett et al., 2010
blood decreased fluid flow, abnormal AB + MO1-igf2a Fig. S6 with image from Hartnett et al., 2010
blood circulation disrupted, abnormal AB + MO1-igf2a Fig. 6 with image,  Fig. S6 with image from Hartnett et al., 2010
brain structure, abnormal AB + MO1-igf2a Fig. 1 with image from Hartnett et al., 2010
bulbus arteriosus morphology, abnormal AB + MO1-igf2a Fig. 6 with image from Hartnett et al., 2010
convergent extension involved in axis elongation delayed, abnormal AB/TU + MO1-igf2a Fig. 3 from White et al., 2009
dorsal/ventral axis specification disrupted, abnormal AB/TU + MO1-igf2a Fig. 3 from White et al., 2009
dorsal/ventral pattern formation disrupted, abnormal AB + MO1-igf2a Fig. S5 with image from Hartnett et al., 2010
eye decreased size, abnormal AB + MO1-igf2a Fig. 1 with image from Hartnett et al., 2010
heart increased size, abnormal AB + MO1-igf2a Fig. 6 with image from Hartnett et al., 2010
heart looping arrested, abnormal AB + MO1-igf2a Fig. 6 with image from Hartnett et al., 2010
intermediate cell mass of mesoderm distended, abnormal AB + MO1-igf2a Fig. 1 with image from Hartnett et al., 2010
notochord undulate, abnormal AB/TU + MO1-igf2a Fig. 3 from White et al., 2009
post-vent vasculature increased accumulation blood, abnormal AB + MO1-igf2a Fig. S6 with image from Hartnett et al., 2010
somite morphology, abnormal AB + MO1-igf2a Fig. 1 with image from Hartnett et al., 2010
spinal cord neural keel apoptotic, abnormal AB + MO1-igf2a Fig. S4 with image from Hartnett et al., 2010
trunk vasculature increased accumulation blood, abnormal AB + MO1-igf2a Fig. S6 with image from Hartnett et al., 2010
vasculature increased accumulation blood, abnormal AB + MO1-igf2a Fig. S6 with image from Hartnett et al., 2010
whole organism curved ventral, abnormal AB/TU + MO1-igf2a Fig. 3 from White et al., 2009
whole organism decreased length, abnormal AB + MO1-igf2a Fig. 1 with image from Hartnett et al., 2010
whole organism wholly ventralized, abnormal AB + MO1-igf2a Fig. 1 with image,  Fig. S5 with image from Hartnett et al., 2010
Phenotype of all Fish created by or utilizing MO1-igf2a
Phenotype Fish Conditions Figures
whole organism decreased length, abnormal AB + MO1-igf2a standard conditions Fig. 1 with image from Hartnett et al., 2010
somite morphology, abnormal AB + MO1-igf2a standard conditions Fig. 1 with image from Hartnett et al., 2010
vasculature increased accumulation blood, abnormal AB + MO1-igf2a standard conditions Fig. S6 with image from Hartnett et al., 2010
post-vent vasculature increased accumulation blood, abnormal AB + MO1-igf2a standard conditions Fig. S6 with image from Hartnett et al., 2010
blood decreased fluid flow, abnormal AB + MO1-igf2a standard conditions Fig. S6 with image from Hartnett et al., 2010
blood circulation disrupted, abnormal AB + MO1-igf2a standard conditions Fig. 6 with image,  Fig. S6 with image from Hartnett et al., 2010
heart increased size, abnormal AB + MO1-igf2a standard conditions Fig. 6 with image from Hartnett et al., 2010
eye decreased size, abnormal AB + MO1-igf2a standard conditions Fig. 1 with image from Hartnett et al., 2010
spinal cord neural keel apoptotic, abnormal AB + MO1-igf2a standard conditions Fig. S4 with image from Hartnett et al., 2010
brain structure, abnormal AB + MO1-igf2a standard conditions Fig. 1 with image from Hartnett et al., 2010
apoptotic process increased occurrence, abnormal AB + MO1-igf2a standard conditions Fig. S4 with image from Hartnett et al., 2010
intermediate cell mass of mesoderm distended, abnormal AB + MO1-igf2a standard conditions Fig. 1 with image from Hartnett et al., 2010
dorsal/ventral pattern formation disrupted, abnormal AB + MO1-igf2a standard conditions Fig. S5 with image from Hartnett et al., 2010
heart looping arrested, abnormal AB + MO1-igf2a standard conditions Fig. 6 with image from Hartnett et al., 2010
bulbus arteriosus morphology, abnormal AB + MO1-igf2a standard conditions Fig. 6 with image from Hartnett et al., 2010
trunk vasculature increased accumulation blood, abnormal AB + MO1-igf2a standard conditions Fig. S6 with image from Hartnett et al., 2010
whole organism wholly ventralized, abnormal AB + MO1-igf2a standard conditions Fig. 1 with image,  Fig. S5 with image from Hartnett et al., 2010
dorsal/ventral axis specification disrupted, abnormal AB/TU + MO1-igf2a standard conditions Fig. 3 from White et al., 2009
notochord undulate, abnormal AB/TU + MO1-igf2a standard conditions Fig. 3 from White et al., 2009
convergent extension involved in axis elongation delayed, abnormal AB/TU + MO1-igf2a standard conditions Fig. 3 from White et al., 2009
whole organism curved ventral, abnormal AB/TU + MO1-igf2a standard conditions Fig. 3 from White et al., 2009
notochord development delayed, abnormal AB/TU + MO1-igf2a + MO2-igf2a + MO4-tp53 standard conditions Fig. 4 from White et al., 2009
somite specification disrupted, abnormal AB/TU + MO1-igf2a + MO2-igf2a + MO4-tp53 standard conditions Fig. 4 from White et al., 2009
notochord undulate, abnormal AB/TU + MO1-igf2a + MO2-igf2a + MO4-tp53 standard conditions Fig. 4 from White et al., 2009
trunk has fewer parts of type somite, abnormal AB/TU + MO1-igf2a + MO2-igf2a + MO4-tp53 standard conditions Fig. 4 from White et al., 2009
angiogenesis disrupted, abnormal y1Tg + MO1-igf2a standard conditions text only from Hartnett et al., 2010
intersegmental vessel sprouting angiogenesis delayed, abnormal y7Tg + MO1-igf2a + MO2-igf2a + MO4-tp53 standard conditions Fig. 4 with image from Dallinga et al., 2018
intersegmental vessel filopodium absent, abnormal y7Tg + MO1-igf2a + MO2-igf2a + MO4-tp53 standard conditions Fig. 4 with image from Dallinga et al., 2018
blood circulation disrupted, abnormal AB + MO1-igf2a + MO3-igf2b standard conditions Fig. 4 with image,  Fig. 6 with image from Hartnett et al., 2010
blood decreased fluid flow, abnormal AB + MO1-igf2a + MO3-igf2b standard conditions Fig. 4 with image from Hartnett et al., 2010
dorsal/ventral pattern formation disrupted, abnormal AB + MO1-igf2a + MO3-igf2b standard conditions Fig. 3 with image from Hartnett et al., 2010
heart looping arrested, abnormal AB + MO1-igf2a + MO3-igf2b standard conditions Fig. 6 with image from Hartnett et al., 2010
whole organism decreased length, abnormal AB + MO1-igf2a + MO3-igf2b standard conditions Fig. 1 with image from Hartnett et al., 2010
brain structure, abnormal AB + MO1-igf2a + MO3-igf2b standard conditions Fig. 1 with image from Hartnett et al., 2010
vasculature increased accumulation blood, abnormal AB + MO1-igf2a + MO3-igf2b standard conditions Fig. 4 with image from Hartnett et al., 2010
intermediate cell mass of mesoderm distended, abnormal AB + MO1-igf2a + MO3-igf2b standard conditions Fig. 1 with image from Hartnett et al., 2010
somite morphology, abnormal AB + MO1-igf2a + MO3-igf2b standard conditions Fig. 1 with image from Hartnett et al., 2010
post-vent vasculature increased accumulation blood, abnormal AB + MO1-igf2a + MO3-igf2b standard conditions Fig. 4 with image from Hartnett et al., 2010
apoptotic process increased occurrence, abnormal AB + MO1-igf2a + MO3-igf2b standard conditions Fig. 2 with image from Hartnett et al., 2010
eye decreased size, abnormal AB + MO1-igf2a + MO3-igf2b standard conditions Fig. 1 with image from Hartnett et al., 2010
bulbus arteriosus morphology, abnormal AB + MO1-igf2a + MO3-igf2b standard conditions Fig. 6 with image from Hartnett et al., 2010
trunk vasculature increased accumulation blood, abnormal AB + MO1-igf2a + MO3-igf2b standard conditions Fig. 4 with image from Hartnett et al., 2010
heart increased size, abnormal AB + MO1-igf2a + MO3-igf2b standard conditions Fig. 6 with image from Hartnett et al., 2010
whole organism wholly ventralized, abnormal AB + MO1-igf2a + MO3-igf2b standard conditions Fig. 1 with image,  Fig. 3 with image from Hartnett et al., 2010
heart contraction decreased occurrence, abnormal AB + MO1-igf2a + MO3-igf2b standard conditions text only from Hartnett et al., 2010
neural keel apoptotic, abnormal AB + MO1-igf2a + MO3-igf2b standard conditions Fig. 2 with image from Hartnett et al., 2010
spinal cord neural keel apoptotic, abnormal AB + MO1-igf2a + MO3-igf2b standard conditions Fig. 2 with image from Hartnett et al., 2010
whole organism curved ventral, abnormal AB/TU + MO1-igf2a + MO1-igf2b + MO2-igf2a + MO2-igf2b + MO4-tp53 standard conditions text only from White et al., 2009
somite specification disrupted, abnormal AB/TU + MO1-igf2a + MO1-igf2b + MO2-igf2a + MO2-igf2b + MO4-tp53 standard conditions Fig. 4 from White et al., 2009
notochord undulate, abnormal AB/TU + MO1-igf2a + MO1-igf2b + MO2-igf2a + MO2-igf2b + MO4-tp53 standard conditions text only from White et al., 2009
trunk has fewer parts of type somite, abnormal AB/TU + MO1-igf2a + MO1-igf2b + MO2-igf2a + MO2-igf2b + MO4-tp53 standard conditions Fig. 4 from White et al., 2009
cranial blood vessel decreased size, abnormal y1Tg + MO1-igf2a + MO3-igf2b standard conditions Fig. 5 with image from Hartnett et al., 2010
angiogenesis disrupted, abnormal y1Tg + MO1-igf2a + MO3-igf2b standard conditions Fig. 5 with image,  Fig. S7 with image,  text only from Hartnett et al., 2010
parachordal vessel hypoplastic, abnormal y1Tg + MO1-igf2a + MO3-igf2b standard conditions Fig. 5 with image from Hartnett et al., 2010
intersegmental vessel decreased size, abnormal y1Tg + MO1-igf2a + MO3-igf2b standard conditions Fig. 5 with image from Hartnett et al., 2010
parachordal vessel morphology, abnormal y1Tg + MO1-igf2a + MO3-igf2b standard conditions Fig. 5 with image from Hartnett et al., 2010
intermediate cell mass of mesoderm distended, abnormal y1Tg + MO1-igf2a + MO3-igf2b standard conditions Fig. 5 with image from Hartnett et al., 2010
intersegmental vessel disorganized, abnormal y1Tg + MO1-igf2a + MO3-igf2b standard conditions Fig. 5 with image from Hartnett et al., 2010
vasculature disorganized, abnormal y1Tg + MO1-igf2a + MO3-igf2b standard conditions Fig. S7 with image from Hartnett et al., 2010
ocular blood vessel decreased size, abnormal y1Tg + MO1-igf2a + MO3-igf2b standard conditions Fig. 5 with image from Hartnett et al., 2010
sprouting angiogenesis decreased occurrence, abnormal y1Tg + MO1-igf2a + MO3-igf2b standard conditions Fig. 5 with image from Hartnett et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.