Morpholino

MO1-duox

ID
ZDB-MRPHLNO-091117-1
Name
MO1-duox
Previous Names
  • MO1-duox1
Target
Sequence
5' - AGTGAATTAGAGAAATGCACCTTTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-duox
No data available
Phenotype
Phenotype resulting from MO1-duox
Phenotype of all Fish created by or utilizing MO1-duox
Phenotype Fish Conditions Figures
kidney Ab3-havcr1 labeling increased amount, abnormal AB + MO1-duox physical alteration: kidney, chemical treatment by injection: gentamycin Fig. 2 from Chen et al., 2019
renal tubule hydrogen peroxide amount, ameliorated AB + MO1-duox physical alteration: kidney, chemical treatment by injection: gentamycin Fig. 1 from Chen et al., 2019
renal tubule structure, exacerbated AB + MO1-duox physical alteration: kidney, chemical treatment by injection: gentamycin Fig. 2 from Chen et al., 2019
renal tubule apoptotic process increased occurrence, exacerbated AB + MO1-duox physical alteration: kidney, chemical treatment by injection: gentamycin Fig. 2 from Chen et al., 2019
regenerating tissue kidney lhx1a expression decreased distribution, abnormal AB + MO1-duox physical alteration: kidney, chemical treatment by injection: gentamycin Fig. 3 from Chen et al., 2019
cell death increased occurrence, abnormal AB + MO1-duox standard conditions text only from Niethammer et al., 2009
renal duct Ab4-pax2a labeling decreased amount, abnormal AB + MO1-duox physical alteration: kidney, chemical treatment by injection: gentamycin Fig. 3 from Chen et al., 2019
regenerating tissue kidney lhx1a expression decreased amount, abnormal AB + MO1-duox physical alteration: kidney, chemical treatment by injection: gentamycin Fig. 3 from Chen et al., 2019
regenerating tissue renal duct Ab4-pax2a labeling decreased distribution, abnormal AB + MO1-duox physical alteration: kidney, chemical treatment by injection: gentamycin Fig. 3 from Chen et al., 2019
renal tubule absent, abnormal AB + MO1-duox physical alteration: kidney, chemical treatment by injection: gentamycin Fig. 2 from Chen et al., 2019
regenerating tissue renal duct Ab4-pax2a labeling decreased amount, abnormal AB + MO1-duox physical alteration: kidney, chemical treatment by injection: gentamycin Fig. 3 from Chen et al., 2019
renal tubule animal organ regeneration decreased occurrence, abnormal AB + MO1-duox physical alteration: kidney, chemical treatment by injection: gentamycin Fig. 3 from Chen et al., 2019
regenerating tissue cell population proliferation decreased occurrence, abnormal AB + MO1-duox physical alteration: kidney, chemical treatment by injection: gentamycin Fig. 3 from Chen et al., 2019
response to wounding disrupted, abnormal AB + MO1-duox + MO4-tp53 physical alteration: caudal fin Fig. 3 from Niethammer et al., 2009
hydrogen peroxide biosynthetic process disrupted, abnormal AB + MO1-duox + MO4-tp53 physical alteration: caudal fin Fig. 3 from Niethammer et al., 2009
leukocyte migration disrupted, abnormal AB + MO1-duox + MO4-tp53 physical alteration: caudal fin Fig. 3 from Niethammer et al., 2009
caudal fin fin regeneration decreased occurrence, abnormal WT + MO1-duox amputation: caudal fin Figure 4 with image from Bernut et al., 2020
leukocyte migration involved in inflammatory response decreased occurrence, abnormal WT + MO1-duox chemical treatment: arachidonic acid Fig. 1 from Katikaneni et al., 2020
inflammatory response to wounding decreased magnitude, abnormal WT + MO1-duox amputation: caudal fin Fig. 2 from Katikaneni et al., 2020
caudal fin neutrophil increased amount, ameliorated i114Tg + MO1-duox amputation: caudal fin Figure 2 with image from Bernut et al., 2020
neutrophil chemotaxis process quality, abnormal i114Tg + MO1-duox + MO4-tp53 standard conditions Fig. 4 with image from Brothers et al., 2013
neutrophil chemotaxis decreased process quality, abnormal i114Tg + MO1-duox + MO4-tp53 amputation: caudal fin Fig. 2 from de Oliveira et al., 2014
neutrophil phagocytosis decreased process quality, abnormal i114Tg + MO1-duox + MO4-tp53 standard conditions Fig. 4 with image from Brothers et al., 2013
defense response to fungus process quality, abnormal i114Tg + MO1-duox + MO4-tp53 standard conditions Fig. 4 with image,  Fig. 5 with image from Brothers et al., 2013
neutrophil chemotaxis decreased process quality, abnormal nz50Tg + MO1-duox + MO4-tp53 amputation: caudal fin Fig. 2 from de Oliveira et al., 2014
peptidyl-tyrosine autophosphorylation decreased occurrence, abnormal uwm5Tg + MO1-duox + MO4-tp53 physical alteration: anatomical structure Fig. 1 from Yoo et al., 2011
macrophage response to wounding process quality, abnormal uwm12Tg + MO1-duox + MO4-tp53 amputation: caudal fin Fig. 3 from Tauzin et al., 2014
macrophage chemotaxis process quality, abnormal uwm12Tg + MO1-duox + MO4-tp53 amputation: caudal fin Fig. 3 from Tauzin et al., 2014
regenerating fin caudal fin EGFP expression decreased amount, abnormal uwm37Tg + MO1-duox + MO4-tp53 (AB) resection: caudal fin Fig. 2 S1 with image from LeBert et al., 2018
caudal fin fin regeneration decreased occurrence, abnormal WT + MO1-duox + MO7-cftr amputation: caudal fin Figure 4 with image from Bernut et al., 2020
caudal fin neutrophil increased amount, ameliorated i114Tg + MO1-duox + MO7-cftr amputation: caudal fin Figure 2 with image from Bernut et al., 2020
Citations