Morpholino

MO1-ihha

ID
ZDB-MRPHLNO-100405-1
Name
MO1-ihha
Previous Names
  • Ihha-MO (1)
Target
Sequence
5' - GGAGACGCATTCCACCGCAAGCG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ihha
No data available
Phenotype
Phenotype resulting from MO1-ihha
Phenotype Fish Figures
enteric neuron decreased amount, abnormal em2Tg + MO1-ihha + MO4-tp53 Fig. 4 with image from Sribudiani et al., 2018
eye decreased size, abnormal em2Tg + MO1-ihha + MO4-tp53 Fig. 4 with image from Sribudiani et al., 2018
head morphology, abnormal em2Tg + MO1-ihha + MO4-tp53 Fig. 4 with image from Sribudiani et al., 2018
pancreas morphology, abnormal WT + MO1-ihha Fig. 6 from Yin et al., 2012
smoothened signaling pathway disrupted, abnormal AB + MO1-ihha Fig. S7 with image from Winata et al., 2009
swim bladder absent, abnormal em2Tg + MO1-ihha + MO4-tp53 Fig. 4 with image from Sribudiani et al., 2018
swim bladder decreased size, abnormal sqet332Et + MO1-ihha Fig. 6 from Yin et al., 2012
Fig. 4 with image from Winata et al., 2009
swim bladder hypoplastic, abnormal AB + MO1-ihha Fig. 4 with imageFig. S3 with imageFig. S7 with image from Winata et al., 2009
swim bladder epithelium decreased size, abnormal AB + MO1-ihha Fig. 4 with image from Winata et al., 2009
swim bladder mesenchyme decreased size, abnormal AB + MO1-ihha Fig. 4 with image from Winata et al., 2009
swim bladder mesenchyme disorganized, abnormal AB + MO1-ihha Fig. 4 with image from Winata et al., 2009
swim bladder mesothelial cell decreased amount, abnormal AB + MO1-ihha Fig. 4 with image from Winata et al., 2009
swim bladder smooth muscle aplastic, abnormal AB + MO1-ihha Fig. 4 with image from Winata et al., 2009
swim bladder bud hypoplastic, abnormal AB + MO1-ihha Fig. S3 with image from Winata et al., 2009
swim bladder development disrupted, abnormal WT + MO1-ihha Fig. 6 from Yin et al., 2012
swim bladder formation disrupted, abnormal AB + MO1-ihha Fig. S7 with image from Winata et al., 2009
swim bladder morphogenesis disrupted, abnormal AB + MO1-ihha + MO4-tp53 Fig. S3 with image from Winata et al., 2009
trunk increased curvature, abnormal em2Tg + MO1-ihha + MO4-tp53 Fig. 4 with image from Sribudiani et al., 2018
Phenotype of all Fish created by or utilizing MO1-ihha
Phenotype Fish Conditions Figures
swim bladder epithelium decreased size, abnormal AB + MO1-ihha standard conditions Fig. 4 with image from Winata et al., 2009
smoothened signaling pathway disrupted, abnormal AB + MO1-ihha standard conditions Fig. S7 with image from Winata et al., 2009
swim bladder bud hypoplastic, abnormal AB + MO1-ihha standard conditions Fig. S3 with image from Winata et al., 2009
swim bladder hypoplastic, abnormal AB + MO1-ihha standard conditions Fig. 4 with imageFig. S3 with imageFig. S7 with image from Winata et al., 2009
swim bladder morphogenesis disrupted, abnormal AB + MO1-ihha standard conditions Fig. S3 with image from Winata et al., 2009
swim bladder smooth muscle aplastic, abnormal AB + MO1-ihha standard conditions Fig. 4 with image from Winata et al., 2009
swim bladder mesenchyme disorganized, abnormal AB + MO1-ihha standard conditions Fig. 4 with image from Winata et al., 2009
swim bladder formation disrupted, abnormal AB + MO1-ihha standard conditions Fig. S7 with image from Winata et al., 2009
swim bladder mesothelial cell decreased amount, abnormal AB + MO1-ihha standard conditions Fig. 4 with image from Winata et al., 2009
swim bladder mesenchyme decreased size, abnormal AB + MO1-ihha standard conditions Fig. 4 with image from Winata et al., 2009
swim bladder morphogenesis disrupted, abnormal AB + MO1-ihha + MO4-tp53 standard conditions Fig. S3 with image from Winata et al., 2009
swim bladder bud hypoplastic, abnormal AB + MO1-ihha + MO4-tp53 standard conditions Fig. S3 with image from Winata et al., 2009
swim bladder hypoplastic, abnormal AB + MO1-ihha + MO4-tp53 standard conditions Fig. S3 with image from Winata et al., 2009
swim bladder decreased size, abnormal WT + MO1-ihha standard conditions Fig. 6 from Yin et al., 2012
swim bladder development disrupted, abnormal WT + MO1-ihha standard conditions Fig. 6 from Yin et al., 2012
pancreas morphology, abnormal WT + MO1-ihha standard conditions Fig. 6 from Yin et al., 2012
head morphology, abnormal em2Tg + MO1-ihha + MO4-tp53 standard conditions Fig. 4 with image from Sribudiani et al., 2018
enteric neuron decreased amount, abnormal em2Tg + MO1-ihha + MO4-tp53 standard conditions Fig. 4 with image from Sribudiani et al., 2018
eye decreased size, abnormal em2Tg + MO1-ihha + MO4-tp53 standard conditions Fig. 4 with image from Sribudiani et al., 2018
swim bladder absent, abnormal em2Tg + MO1-ihha + MO4-tp53 standard conditions Fig. 4 with image from Sribudiani et al., 2018
trunk increased curvature, abnormal em2Tg + MO1-ihha + MO4-tp53 standard conditions Fig. 4 with image from Sribudiani et al., 2018
swim bladder decreased size, abnormal sqet332Et + MO1-ihha standard conditions Fig. 4 with image from Winata et al., 2009
swim bladder decreased size, abnormal fgf10atbvbo/tbvbo; sqet332Et + MO1-ihha standard conditions Fig. 8 with image from Korzh et al., 2011
pneumatic duct decreased size, abnormal fgf10atbvbo/tbvbo; sqet332Et + MO1-ihha standard conditions Fig. 8 with image from Korzh et al., 2011
Citations