Morpholino

MO1-nes

ID
ZDB-MRPHLNO-100423-15
Name
MO1-nes
Previous Names
None
Target
Sequence
5' - CGAGAGATATGAAGTGAAATCTCAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nes
No data available
Phenotype
Phenotype resulting from MO1-nes
Phenotype Fish Figures
brain apoptotic, abnormal AB + MO1-nes Fig. 7 with image from Chen et al., 2010
brain decreased size, abnormal AB + MO1-nes Fig. 2 with imagetext only from Chen et al., 2010
brain hydrocephalic, abnormal AB + MO1-nes Fig. 2 with imagetext only from Chen et al., 2010
brain development disrupted, abnormal AB + MO1-nes Fig. 2 with image from Chen et al., 2010
cranial nerve III decreased size, abnormal rw0Tg + MO1-nes Fig. 6 with image from Chen et al., 2010
cranial nerve IV decreased size, abnormal rw0Tg + MO1-nes Fig. 6 with image from Chen et al., 2010
cranial nerve V decreased size, abnormal rw0Tg + MO1-nes Fig. 6 with image from Chen et al., 2010
cranial nerve V disorganized, abnormal rw0Tg + MO1-nes Fig. 6 with image from Chen et al., 2010
cranial nerve VII decreased size, abnormal rw0Tg + MO1-nes Fig. 6 with image from Chen et al., 2010
cranial nerve VII disorganized, abnormal rw0Tg + MO1-nes Fig. 6 with image from Chen et al., 2010
cranial nerve X morphology, abnormal rw0Tg + MO1-nes Fig. 6 with image from Chen et al., 2010
cranial nerve X position, abnormal rw0Tg + MO1-nes Fig. 6 with image from Chen et al., 2010
eye apoptotic, abnormal AB + MO1-nes Fig. 7 with image from Chen et al., 2010
eye decreased size, abnormal AB + MO1-nes Fig. 2 with imagetext only from Chen et al., 2010
eye disorganized, abnormal AB + MO1-nes Fig. 2 with imagetext only from Chen et al., 2010
fourth ventricle dilated, abnormal AB + MO1-nes Fig. 4 with image from Chen et al., 2010
glial cell decreased amount, abnormal mi2001Tg/+ + MO1-nes (AB) Fig. 6 with image from Chen et al., 2010
head decreased size, abnormal AB + MO1-nes Fig. 2 with imagetext only from Chen et al., 2010
head malformed, abnormal AB + MO1-nes Fig. 2 with image from Chen et al., 2010
hindbrain apoptotic, abnormal AB + MO1-nes Fig. 7 with imageFig. 8 with image from Chen et al., 2010
hindbrain decreased size, abnormal AB + MO1-nes Fig. 4 with image from Chen et al., 2010
hindbrain disorganized, abnormal AB + MO1-nes Fig. 4 with image from Chen et al., 2010
lens hypoplastic, abnormal AB + MO1-nes Fig. 4 with image from Chen et al., 2010
midbrain apoptotic, abnormal AB + MO1-nes Fig. 7 with image from Chen et al., 2010
midbrain decreased size, abnormal AB + MO1-nes Fig. 4 with image from Chen et al., 2010
midbrain disorganized, abnormal AB + MO1-nes Fig. 4 with image from Chen et al., 2010
midbrain-hindbrain boundary development disrupted, abnormal AB + MO1-nes Fig. 2 with image from Chen et al., 2010
nervous system axon spatial pattern, abnormal rw0Tg + MO1-nes Fig. 6 with image from Chen et al., 2010
optic tectum decreased size, abnormal AB + MO1-nes Fig. 2 with imagetext only from Chen et al., 2010
retina disorganized, abnormal AB + MO1-nes Fig. 4 with image from Chen et al., 2010
tectal ventricle dilated, abnormal AB + MO1-nes Fig. 4 with image from Chen et al., 2010
Phenotype of all Fish created by or utilizing MO1-nes
Phenotype Fish Conditions Figures
midbrain apoptotic, abnormal AB + MO1-nes standard conditions Fig. 7 with image from Chen et al., 2010
brain hydrocephalic, abnormal AB + MO1-nes standard conditions Fig. 2 with imagetext only from Chen et al., 2010
brain apoptotic, abnormal AB + MO1-nes standard conditions Fig. 7 with image from Chen et al., 2010
hindbrain disorganized, abnormal AB + MO1-nes standard conditions Fig. 4 with image from Chen et al., 2010
head malformed, abnormal AB + MO1-nes standard conditions Fig. 2 with image from Chen et al., 2010
midbrain decreased size, abnormal AB + MO1-nes standard conditions Fig. 4 with image from Chen et al., 2010
eye disorganized, abnormal AB + MO1-nes standard conditions Fig. 2 with imagetext only from Chen et al., 2010
fourth ventricle dilated, abnormal AB + MO1-nes standard conditions Fig. 4 with image from Chen et al., 2010
eye decreased size, abnormal AB + MO1-nes standard conditions Fig. 2 with imagetext only from Chen et al., 2010
eye apoptotic, abnormal AB + MO1-nes standard conditions Fig. 7 with image from Chen et al., 2010
hindbrain decreased size, abnormal AB + MO1-nes standard conditions Fig. 4 with image from Chen et al., 2010
retina disorganized, abnormal AB + MO1-nes standard conditions Fig. 4 with image from Chen et al., 2010
hindbrain apoptotic, abnormal AB + MO1-nes standard conditions Fig. 7 with imageFig. 8 with image from Chen et al., 2010
optic tectum decreased size, abnormal AB + MO1-nes standard conditions Fig. 2 with imagetext only from Chen et al., 2010
brain decreased size, abnormal AB + MO1-nes standard conditions Fig. 2 with imagetext only from Chen et al., 2010
midbrain-hindbrain boundary development disrupted, abnormal AB + MO1-nes standard conditions Fig. 2 with image from Chen et al., 2010
tectal ventricle dilated, abnormal AB + MO1-nes standard conditions Fig. 4 with image from Chen et al., 2010
head decreased size, abnormal AB + MO1-nes standard conditions Fig. 2 with imagetext only from Chen et al., 2010
midbrain disorganized, abnormal AB + MO1-nes standard conditions Fig. 4 with image from Chen et al., 2010
lens hypoplastic, abnormal AB + MO1-nes standard conditions Fig. 4 with image from Chen et al., 2010
brain development disrupted, abnormal AB + MO1-nes standard conditions Fig. 2 with image from Chen et al., 2010
glial cell decreased amount, abnormal mi2001Tg/+ + MO1-nes (AB) standard conditions Fig. 6 with image from Chen et al., 2010
cranial nerve V decreased size, abnormal rw0Tg + MO1-nes standard conditions Fig. 6 with image from Chen et al., 2010
cranial nerve III decreased size, abnormal rw0Tg + MO1-nes standard conditions Fig. 6 with image from Chen et al., 2010
cranial nerve X position, abnormal rw0Tg + MO1-nes standard conditions Fig. 6 with image from Chen et al., 2010
cranial nerve X morphology, abnormal rw0Tg + MO1-nes standard conditions Fig. 6 with image from Chen et al., 2010
cranial nerve VII decreased size, abnormal rw0Tg + MO1-nes standard conditions Fig. 6 with image from Chen et al., 2010
cranial nerve V disorganized, abnormal rw0Tg + MO1-nes standard conditions Fig. 6 with image from Chen et al., 2010
cranial nerve IV decreased size, abnormal rw0Tg + MO1-nes standard conditions Fig. 6 with image from Chen et al., 2010
cranial nerve VII disorganized, abnormal rw0Tg + MO1-nes standard conditions Fig. 6 with image from Chen et al., 2010
nervous system axon spatial pattern, abnormal rw0Tg + MO1-nes standard conditions Fig. 6 with image from Chen et al., 2010
Citations