Morpholino

MO1-etv5a

ID
ZDB-MRPHLNO-100621-4
Name
MO1-etv5a
Previous Names
None
Target
Sequence
5' - ATACATTAGGGAGTACCTGTAGCTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-etv5a
No data available
Phenotype
Phenotype resulting from MO1-etv5a
Phenotype of all Fish created by or utilizing MO1-etv5a
Phenotype Fish Conditions Figures
pronephric duct cimap1b expression decreased distribution, abnormal TU + MO1-etv5a chemical treatment by environment: prostaglandin E2 Fig. 5 with image from Marra et al., 2019
pronephric duct multi-ciliated epithelial cell decreased amount, ameliorated TU + MO1-etv5a chemical treatment by environment: prostaglandin E2 Fig. 5 with image from Marra et al., 2019
pronephric duct multi-ciliated epithelial cell decreased amount, abnormal TU + MO1-etv5a control Fig. 5 with image from Marra et al., 2019
pronephric duct cimap1b expression decreased distribution, abnormal TU + MO1-etv5a control Fig. 5 with image from Marra et al., 2019
head hemorrhagic, abnormal WT + MO1-etv5a standard conditions Fig. 2 with image from Marra et al., 2016
pronephros cimap1b expression spatial pattern, ameliorated WT + MO1-etv5a chemical treatment: all-trans-retinoic acid Fig. 5 with image from Marra et al., 2016
head decreased size, abnormal WT + MO1-etv5a standard conditions Fig. 2 with image from Marra et al., 2016
pronephric nephron tubule epithelial cell differentiation process quality, abnormal WT + MO1-etv5a chemical treatment: 4-(diethylamino)benzaldehyde Fig. 5 with image from Marra et al., 2016
pronephric proximal straight tubule has fewer parts of type pronephric proximal straight tubule multi-ciliated epithelial cell, abnormal WT + MO1-etv5a standard conditions Fig. 3 with image from Marra et al., 2016
pronephros cimap1b expression decreased distribution, abnormal WT + MO1-etv5a control Fig. 5 with imageFig. 6 with image from Marra et al., 2016
pronephric nephron tubule epithelial cell differentiation process quality, abnormal WT + MO1-etv5a chemical treatment: DAPT Fig. 6 with image from Marra et al., 2016
pronephros cimap1b expression absent, abnormal WT + MO1-etv5a chemical treatment: 4-(diethylamino)benzaldehyde Fig. 5 with image from Marra et al., 2016
pronephros multi-ciliated epithelial cell differentiation occurrence, ameliorated WT + MO1-etv5a chemical treatment: all-trans-retinoic acid Fig. 5 with image from Marra et al., 2016
pronephric nephron tubule epithelial cell differentiation process quality, abnormal WT + MO1-etv5a standard conditions Fig. 2 with imageFig. 3 with imageFig. 4 with imageFig. 5 with imageFig. 6 with image from Marra et al., 2016
pronephros multi-ciliated epithelial cell differentiation increased occurrence, abnormal WT + MO1-etv5a chemical treatment: DAPT Fig. 6 with image from Marra et al., 2016
pronephros has fewer parts of type pronephros multi-ciliated epithelial cell, abnormal WT + MO1-etv5a standard conditions Fig. 2 with imageFig. 4 with imageFig. 5 with imageFig. 6 with image from Marra et al., 2016
renal system process decreased occurrence, abnormal WT + MO1-etv5a standard conditions Fig. 2 with image from Marra et al., 2016
heart edematous, abnormal WT + MO1-etv5a standard conditions Fig. 2 with image from Marra et al., 2016
pronephros multi-ciliated epithelial cell differentiation arrested, abnormal WT + MO1-etv5a chemical treatment: 4-(diethylamino)benzaldehyde Fig. 5 with image from Marra et al., 2016
pronephric proximal straight tubule has number of pronephric proximal straight tubule multi-ciliated epithelial cell, ameliorated WT + MO1-etv5a chemical treatment: all-trans-retinoic acid Fig. 5 with image from Marra et al., 2016
pronephros has extra parts of type pronephros multi-ciliated epithelial cell, abnormal WT + MO1-etv5a chemical treatment: DAPT Fig. 6 with image from Marra et al., 2016
pronephric nephron tubule epithelial cell differentiation process quality, ameliorated WT + MO1-etv5a chemical treatment: all-trans-retinoic acid Fig. 5 with image from Marra et al., 2016
pronephric proximal straight tubule lacks all parts of type pronephric proximal straight tubule multi-ciliated epithelial cell, abnormal WT + MO1-etv5a chemical treatment: 4-(diethylamino)benzaldehyde Fig. 5 with image from Marra et al., 2016
pronephros cimap1b expression increased distribution, abnormal WT + MO1-etv5a chemical treatment: DAPT Fig. 6 with image from Marra et al., 2016
pronephros multi-ciliated epithelial cell differentiation decreased occurrence, abnormal WT + MO1-etv5a standard conditions Fig. 2 with imageFig. 3 with imageFig. 4 with imageFig. 5 with imageFig. 6 with image from Marra et al., 2016
pronephric nephron tubule epithelial cell differentiation process quality, abnormal WT + MO1-etv5a + MO2-etv4 standard conditions Fig. 4 with image from Marra et al., 2016
pronephros has fewer parts of type pronephros multi-ciliated epithelial cell, abnormal WT + MO1-etv5a + MO2-etv4 standard conditions Fig. 4 with image from Marra et al., 2016
pronephros multi-ciliated epithelial cell differentiation decreased occurrence, abnormal WT + MO1-etv5a + MO2-etv4 standard conditions Fig. 4 with image from Marra et al., 2016
pectoral fin bud decreased size, abnormal WT + MO1-etv5a + MO2-etv4 + MO2-etv5b standard conditions Fig. 3 with image from Mao et al., 2009
Citations