Morpholino

MO3-ppp1r12a

ID
ZDB-MRPHLNO-101006-1
Name
MO3-ppp1r12a
Previous Names
  • mypt1 MO (1)
Target
Sequence
5' - GGCGTCCGCCATCTTCATCCCCTCG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-ppp1r12a
No data available
Phenotype
Phenotype resulting from MO3-ppp1r12a
Phenotype Fish Figures
anterior axial hypoblast bleb increased amount, abnormal WT + MO3-ppp1r12a Fig. 4 with image from Diz-Munoz et al., 2010
anterior axial hypoblast filopodium decreased amount, abnormal WT + MO3-ppp1r12a Fig. 4 with image from Diz-Munoz et al., 2010
anterior axial hypoblast lamellipodium decreased amount, abnormal WT + MO3-ppp1r12a Fig. 4 with image from Diz-Munoz et al., 2010
axis decreased length, abnormal WIK/AB + MO3-ppp1r12a Fig. 1 with image from Weiser et al., 2009
cell migration involved in mesendoderm migration decreased process quality, abnormal WT + MO3-ppp1r12a Fig. 4 with image from Diz-Munoz et al., 2010
convergent extension involved in axis elongation disrupted, abnormal WIK/AB + MO3-ppp1r12a Fig. 1 with image from Weiser et al., 2009
convergent extension involved in gastrulation disrupted, abnormal AB/TU + MO3-ppp1r12a Fig. 7 with image from LaFlamme et al., 2018
cytoskeleton organization increased process quality, abnormal WT + MO3-ppp1r12a Fig. 4 with image from Diz-Munoz et al., 2010
mesodermal cell bleb increased amount, abnormal WIK/AB + MO3-ppp1r12a Fig. 5 with imageFig. 6 with image from Weiser et al., 2009
notochord increased width, abnormal AB/TU + MO3-ppp1r12a Fig. 7 with image from LaFlamme et al., 2018
notochord mesodermal cell morphology, abnormal WIK/AB + MO3-ppp1r12a Fig. 4 with image from Weiser et al., 2009
prechordal plate formation decreased process quality, abnormal WT + MO3-ppp1r12a Fig. 4 with image from Diz-Munoz et al., 2010
segmental plate mesodermal cell decreased cellular motility, abnormal WIK/AB + MO3-ppp1r12a Fig. 4 with image from Weiser et al., 2009
segmental plate mesodermal cell morphology, abnormal WIK/AB + MO3-ppp1r12a Fig. 4 with image from Weiser et al., 2009
whole organism ppp1r12a expression decreased amount, abnormal WIK/AB + MO3-ppp1r12a Fig. 1 with image from Weiser et al., 2009
whole organism anterior-posterior axis truncated, abnormal AB/TU + MO3-ppp1r12a Fig. 7 with image from LaFlamme et al., 2018
Phenotype of all Fish created by or utilizing MO3-ppp1r12a
Phenotype Fish Conditions Figures
notochord increased width, abnormal AB/TU + MO3-ppp1r12a standard conditions Fig. 7 with image from LaFlamme et al., 2018
whole organism anterior-posterior axis truncated, abnormal AB/TU + MO3-ppp1r12a standard conditions Fig. 7 with image from LaFlamme et al., 2018
convergent extension involved in gastrulation disrupted, abnormal AB/TU + MO3-ppp1r12a standard conditions Fig. 7 with image from LaFlamme et al., 2018
whole organism ppp1r12a expression decreased amount, abnormal WIK/AB + MO3-ppp1r12a standard conditions Fig. 1 with image from Weiser et al., 2009
axis decreased length, abnormal WIK/AB + MO3-ppp1r12a standard conditions Fig. 1 with image from Weiser et al., 2009
mesodermal cell bleb increased amount, abnormal WIK/AB + MO3-ppp1r12a standard conditions Fig. 5 with imageFig. 6 with image from Weiser et al., 2009
segmental plate mesodermal cell morphology, abnormal WIK/AB + MO3-ppp1r12a standard conditions Fig. 4 with image from Weiser et al., 2009
notochord mesodermal cell morphology, abnormal WIK/AB + MO3-ppp1r12a standard conditions Fig. 4 with image from Weiser et al., 2009
convergent extension involved in axis elongation disrupted, abnormal WIK/AB + MO3-ppp1r12a standard conditions Fig. 1 with image from Weiser et al., 2009
segmental plate mesodermal cell decreased cellular motility, abnormal WIK/AB + MO3-ppp1r12a standard conditions Fig. 4 with image from Weiser et al., 2009
mesodermal cell bleb normal amount, ameliorated WIK/AB + MO3-ppp1r12a chemical treatment by environment: blebbistatin Fig. 6 with image from Weiser et al., 2009
cytoskeleton organization increased process quality, abnormal WT + MO3-ppp1r12a standard conditions Fig. 4 with image from Diz-Munoz et al., 2010
prechordal plate formation decreased process quality, abnormal WT + MO3-ppp1r12a standard conditions Fig. 4 with image from Diz-Munoz et al., 2010
anterior axial hypoblast filopodium decreased amount, abnormal WT + MO3-ppp1r12a standard conditions Fig. 4 with image from Diz-Munoz et al., 2010
anterior axial hypoblast bleb increased amount, abnormal WT + MO3-ppp1r12a standard conditions Fig. 4 with image from Diz-Munoz et al., 2010
anterior axial hypoblast lamellipodium decreased amount, abnormal WT + MO3-ppp1r12a standard conditions Fig. 4 with image from Diz-Munoz et al., 2010
cell migration involved in mesendoderm migration decreased process quality, abnormal WT + MO3-ppp1r12a standard conditions Fig. 4 with image from Diz-Munoz et al., 2010
gastrulation process quality, abnormal WT + MO1-ppp1cbl + MO2-ppp1cb + MO3-ppp1r12a standard conditions Fig. 9 with image from Jayashankar et al., 2013
axis elongation decreased process quality, abnormal WT + MO1-ppp1cbl + MO2-ppp1cb + MO3-ppp1r12a standard conditions Fig. 9 with image from Jayashankar et al., 2013
whole organism anterior-posterior axis shortened, abnormal WT + MO1-ppp1cbl + MO2-ppp1cb + MO3-ppp1r12a standard conditions Fig. 9 with image from Jayashankar et al., 2013
Citations