Morpholino

MO2-tfap2e

ID

ZDB-MRPHLNO-101013-2

Name

MO2-tfap2e

Previous Names

tfap2e e3i3 (1)

Target

tfap2e (1)

Sequence

5' - CACATGCAGACTCTCACCTTTCTTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-tfap2e

No data available

Phenotype

Phenotype resulting from MO2-tfap2e

Phenotype	Fish	Figures
brain hydrocephalic, abnormal	sb2Tg + MO2-tfap2e	Fig. 4 from Kalanithy et al., 2024
ceratohyal cartilage morphology, abnormal	AB/TL + MO2-tfap2e	Fig. 3 from Kalanithy et al., 2024
cranial cartilage hypoplastic, abnormal	AB/TL + MO2-tfap2e	Fig. 3 from Kalanithy et al., 2024
cranial skeletal system development process quality, abnormal	AB/TL + MO2-tfap2e	Fig. 3 from Kalanithy et al., 2024
dorsal root ganglion neuron decreased amount, abnormal	sb2Tg + MO2-tfap2e	Fig. 3 from Kalanithy et al., 2024
head decreased size, abnormal	AB/TL + MO2-tfap2e	Fig. 2 from Kalanithy et al., 2024
hyosymplectic cartilage morphology, abnormal	AB/TL + MO2-tfap2e	Fig. 3 from Kalanithy et al., 2024
Meckel's cartilage morphology, abnormal	AB/TL + MO2-tfap2e	Fig. 3 from Kalanithy et al., 2024
palatoquadrate cartilage morphology, abnormal	AB/TL + MO2-tfap2e	Fig. 3 from Kalanithy et al., 2024
whole organism tfap2e expression decreased amount, abnormal	AB/TL + MO2-tfap2e	Fig. 2 from Kalanithy et al., 2024
whole organism decreased life span, abnormal	AB/TL + MO2-tfap2e	Fig. 2 from Kalanithy et al., 2024
whole organism decreased pigmentation, abnormal	AB/TL + MO2-tfap2e	Fig. 2 from Kalanithy et al., 2024
whole organism increased curvature, abnormal	AB/TL + MO2-tfap2e	Fig. 2 from Kalanithy et al., 2024

Phenotype of all Fish created by or utilizing MO2-tfap2e

Phenotype	Fish	Conditions	Figures
whole organism decreased pigmentation, abnormal	AB/TL + MO2-tfap2e	control	Fig. 2 from Kalanithy et al., 2024
whole organism increased curvature, abnormal	AB/TL + MO2-tfap2e	control	Fig. 2 from Kalanithy et al., 2024
ceratohyal cartilage morphology, abnormal	AB/TL + MO2-tfap2e	control	Fig. 3 from Kalanithy et al., 2024
hyosymplectic cartilage morphology, abnormal	AB/TL + MO2-tfap2e	control	Fig. 3 from Kalanithy et al., 2024
head decreased size, abnormal	AB/TL + MO2-tfap2e	control	Fig. 2 from Kalanithy et al., 2024
palatoquadrate cartilage morphology, abnormal	AB/TL + MO2-tfap2e	control	Fig. 3 from Kalanithy et al., 2024
whole organism decreased life span, abnormal	AB/TL + MO2-tfap2e	control	Fig. 2 from Kalanithy et al., 2024
cranial cartilage hypoplastic, abnormal	AB/TL + MO2-tfap2e	control	Fig. 3 from Kalanithy et al., 2024
Meckel's cartilage morphology, abnormal	AB/TL + MO2-tfap2e	control	Fig. 3 from Kalanithy et al., 2024
cranial skeletal system development process quality, abnormal	AB/TL + MO2-tfap2e	control	Fig. 3 from Kalanithy et al., 2024
whole organism tfap2e expression decreased amount, abnormal	AB/TL + MO2-tfap2e	standard conditions	Fig. 2 from Kalanithy et al., 2024
brain hydrocephalic, abnormal	sb2Tg + MO2-tfap2e	control	Fig. 4 from Kalanithy et al., 2024
dorsal root ganglion neuron decreased amount, abnormal	sb2Tg + MO2-tfap2e	control	Fig. 3 from Kalanithy et al., 2024
melanocyte differentiation disrupted, abnormal	tfap2a^ts213/ts213 + MO2-tfap2e + MO4-tp53	standard conditions	Fig. 3 , Fig. 5 from Van Otterloo et al., 2010
melanocyte decreased amount, abnormal	tfap2a^ts213/ts213 + MO2-tfap2e + MO4-tp53	standard conditions	Fig. 3 , Fig. 5 from Van Otterloo et al., 2010
pigment cell decreased amount, abnormal	tfap2a^ts213/ts213 + MO2-tfap2e + MO4-tp53	standard conditions	Fig. 4 from Van Otterloo et al., 2010
melanocyte decreased amount, abnormal	WT + MO2-tfap2a + MO2-tfap2e + MO4-tp53	standard conditions	Fig. 7 from Van Otterloo et al., 2010
melanocyte differentiation disrupted, abnormal	WT + MO2-tfap2a + MO2-tfap2e + MO4-tp53	standard conditions	Fig. 6 , Fig. 7 , Fig. 8 from Van Otterloo et al., 2010
melanocyte pigment granule decreased amount, abnormal	WT + MO2-tfap2a + MO2-tfap2e + MO4-tp53	standard conditions	Fig. 7 , Fig. 8 from Van Otterloo et al., 2010

Citations