Morpholino

MO2-noto

ID
ZDB-MRPHLNO-110304-4
Name
MO2-noto
Previous Names
  • MO2-flh
Target
Sequence
5' - GTAAGCTCTTCCGGGAATCTGCATG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-noto
No data available
Phenotype
Phenotype resulting from MO2-noto
Phenotype of all Fish created by or utilizing MO2-noto
Phenotype Fish Conditions Figures
floor plate disorganized, abnormal WT + MO2-noto standard conditions Fig. 8 with imageFig. S5 with image from Dal-Pra et al., 2011
notochord aplastic, abnormal WT + MO2-noto standard conditions Fig. S5 with image from Dal-Pra et al., 2011
paraxial mesoderm left side fused with paraxial mesoderm right side, abnormal WT + MO2-noto standard conditions Fig. S5 with image from Dal-Pra et al., 2011
somite fused with somite, abnormal WT + MO2-noto standard conditions Fig. S5 with image from Dal-Pra et al., 2011
hypochord disorganized, abnormal WT + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
paraxial mesoderm increased area, abnormal WT + MO2-noto standard conditions Fig. 8 with imageFig. S5 with image from Dal-Pra et al., 2011
axial chorda mesoderm decreased width, abnormal WT + MO2-noto standard conditions Fig. 8 with imageFig. S5 with image from Dal-Pra et al., 2011
hypochord aplastic, abnormal WT + MO2-noto standard conditions Fig. S5 with image from Dal-Pra et al., 2011
notochord disorganized, abnormal WT + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
paraxial mesoderm increased area, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
notochord aplastic, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
hypochord aplastic, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
floor plate aplastic, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
axial chorda mesoderm aplastic, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
paraxial mesoderm left side fused with paraxial mesoderm right side, abnormal WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto standard conditions Fig. 8 with image from Dal-Pra et al., 2011
Citations