Morpholino
MO2-akt2
- ID
- ZDB-MRPHLNO-110309-1
- Name
- MO2-akt2
- Previous Names
- None
- Target
- Sequence
-
5' - AGCTGCAAAGACAAACGCCATTCAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
After correspondence with the authors, the sequence that was originally published was determined to be the complement of the akt2 transcript. The published sequence was thus reversed to generate the correct MO sequence as found in ZFIN.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-akt2
No data available
Phenotype
Phenotype resulting from MO2-akt2
| Phenotype | Fish | Figures |
|---|---|---|
| head opaque, abnormal | WT + MO2-akt2 |
Fig. 1
from Jensen et al., 2010 |
| whole organism dead, abnormal | WT + MO2-akt2 |
text only
from Jensen et al., 2010 |
Phenotype of all Fish created by or utilizing MO2-akt2
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| whole organism dead, abnormal | WT + MO2-akt2 | standard conditions |
text only
from Jensen et al., 2010 |
| head opaque, abnormal | WT + MO2-akt2 | standard conditions |
Fig. 1
from Jensen et al., 2010 |
Citations