Morpholino

MO1-mapk14a

ID
ZDB-MRPHLNO-110406-1
Name
MO1-mapk14a
Previous Names
None
Target
Sequence
5' - AGTGGGTCTTTCTTTCTGCGACATG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mapk14a
No data available
Phenotype
Phenotype resulting from MO1-mapk14a
Phenotype of all Fish created by or utilizing MO1-mapk14a
Phenotype Fish Conditions Figures
retinal ganglion cell cysteine-type endopeptidase activity decreased occurrence, abnormal WT + MO1-mapk14a standard conditions Fig. 1 with image from Campbell et al., 2013
somitogenesis disrupted, abnormal WT + MO1-mapk14a standard conditions Fig. 2,  Fig. 5 from Hsu et al., 2011
retinal ganglion cell collateral sprouting in absence of injury occurrence, abnormal WT + MO1-mapk14a standard conditions Fig. 4 with image from Campbell et al., 2013
retinal ganglion cell axon collateral physical object quality, abnormal WT + MO1-mapk14a standard conditions Fig. 1 with image,  Fig. 4 with image from Campbell et al., 2013
retinal ganglion cell axon physical object quality, abnormal WT + MO1-mapk14a standard conditions Fig. 1 with image from Campbell et al., 2013
retinal ganglion cell neuron remodeling decreased process quality, abnormal WT + MO1-mapk14a standard conditions Fig. 4 with image from Campbell et al., 2013
somite border U-shaped, abnormal twu3Tg + MO1-mapk14a standard conditions Fig. S2 from Hsu et al., 2011
post-vent region curved dorsal, abnormal twu3Tg + MO1-mapk14a standard conditions Fig. S2 from Hsu et al., 2011
somitogenesis disrupted, abnormal twu3Tg + MO1-mapk14a standard conditions Fig. S2 from Hsu et al., 2011
retinal ganglion cell axon collateral increased length, abnormal WT + MO1-mapk14a + MO1-slit1a standard conditions Fig. 7 with image from Campbell et al., 2013
retinal ganglion cell axon increased branchiness, abnormal WT + MO1-mapk14a + MO1-slit1a standard conditions Fig. 7 with image from Campbell et al., 2013
retinal ganglion cell collateral sprouting in absence of injury increased occurrence, abnormal WT + MO1-mapk14a + MO1-slit1a standard conditions Fig. 7 with image from Campbell et al., 2013
retinal ganglion cell axon has extra parts of type retinal ganglion cell presynaptic active zone, abnormal WT + MO1-mapk14a + MO1-slit1a standard conditions Fig. 7 with image from Campbell et al., 2013
retinal ganglion cell axon increased branchiness, abnormal WT + MO1-mapk14a + MO3-robo2 standard conditions Fig. 7 with image from Campbell et al., 2013
retinal ganglion cell axon collateral increased length, abnormal WT + MO1-mapk14a + MO3-robo2 standard conditions Fig. 7 with image from Campbell et al., 2013
retinal ganglion cell collateral sprouting in absence of injury increased occurrence, abnormal WT + MO1-mapk14a + MO3-robo2 standard conditions Fig. 7 with image from Campbell et al., 2013
retinal ganglion cell axon has extra parts of type retinal ganglion cell presynaptic active zone, abnormal WT + MO1-mapk14a + MO3-robo2 standard conditions Fig. 7 with image from Campbell et al., 2013
Citations