Morpholino

MO3-ctcf

ID
ZDB-MRPHLNO-110420-1
Name
MO3-ctcf
Previous Names
  • ctcfATG (1)
Target
Sequence
5' - CGGCCTCAGTCGGTCCCCCTTCCATG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-ctcf
No data available
Phenotype
Phenotype resulting from MO3-ctcf
Phenotype Fish Figures
anatomical structure myog expression decreased amount, abnormal WT + MO3-ctcf Fig. 5 from Delgado-Olguin et al., 2011
brain segmentation decreased process quality, abnormal WT + MO3-ctcf Fig. 4 with imageFig. 5 with image from Carmona-Aldana et al., 2018
dorsal oblique extraocular muscle myog expression absent, abnormal WT + MO3-ctcf Fig. 5 from Delgado-Olguin et al., 2011
eye hypoplastic, abnormal WT + MO3-ctcf Fig. 4 with imageFig. 5 with image from Carmona-Aldana et al., 2018
forebrain morphology, abnormal WT + MO3-ctcf Fig. 4 with imageFig. 5 with image from Carmona-Aldana et al., 2018
head shape, abnormal WT + MO3-ctcf Fig. 5 with image from Carmona-Aldana et al., 2018
hindbrain morphology, abnormal WT + MO3-ctcf Fig. 4 with imageFig. 5 with image from Carmona-Aldana et al., 2018
hypaxial myotome region myog expression absent, abnormal WT + MO3-ctcf Fig. 5 from Delgado-Olguin et al., 2011
lateral rectus myog expression absent, abnormal WT + MO3-ctcf Fig. 5 from Delgado-Olguin et al., 2011
levator arcus palatini myog expression absent, abnormal WT + MO3-ctcf Fig. 5 from Delgado-Olguin et al., 2011
midbrain morphology, abnormal WT + MO3-ctcf Fig. 4 with imageFig. 5 with image from Carmona-Aldana et al., 2018
muscle myog expression decreased amount, abnormal WT + MO3-ctcf Fig. 6 from Delgado-Olguin et al., 2011
muscle cell decreased amount, abnormal WT + MO3-ctcf Fig. 5 from Delgado-Olguin et al., 2011
notochord morphology, abnormal WT + MO3-ctcf Fig. 4 with imageFig. 5 with image from Carmona-Aldana et al., 2018
pectoral fin musculature myog expression decreased amount, abnormal WT + MO3-ctcf Fig. 5 from Delgado-Olguin et al., 2011
post-vent region decreased size, abnormal WT + MO3-ctcf Fig. 4 with imageFig. 5 with image from Carmona-Aldana et al., 2018
post-vent region increased curvature, abnormal WT + MO3-ctcf Fig. 5 from Delgado-Olguin et al., 2011
post-vent region shape, abnormal WT + MO3-ctcf Fig. 5 with image from Carmona-Aldana et al., 2018
skeletal muscle tissue development disrupted, abnormal WT + MO3-ctcf Fig. 5Fig. 6 from Delgado-Olguin et al., 2011
somite disorganized, abnormal WT + MO3-ctcf Fig. 5 from Delgado-Olguin et al., 2011
somite morphology, abnormal WT + MO3-ctcf Fig. 4 with imageFig. 5 with image from Carmona-Aldana et al., 2018
Fig. 6 from Delgado-Olguin et al., 2011
somite shape, abnormal WT + MO3-ctcf Fig. 5 from Delgado-Olguin et al., 2011
somitogenesis disrupted, abnormal WT + MO3-ctcf Fig. 5 from Delgado-Olguin et al., 2011
ventral mandibular arch myog expression absent, abnormal WT + MO3-ctcf Fig. 5 from Delgado-Olguin et al., 2011
ventral transverse myog expression absent, abnormal WT + MO3-ctcf Fig. 5 from Delgado-Olguin et al., 2011
whole organism myod1 expression decreased amount, abnormal WT + MO3-ctcf Fig. 6 from Delgado-Olguin et al., 2011
whole organism ctcf expression decreased amount, abnormal WT + MO3-ctcf Fig. 3 from Carmona-Aldana et al., 2018
whole organism myog expression decreased amount, abnormal WT + MO3-ctcf Fig. 6 from Delgado-Olguin et al., 2011
whole organism decreased length, abnormal WT + MO3-ctcf Fig. 4 with imageFig. 5 with image from Carmona-Aldana et al., 2018
Fig. 6 from Delgado-Olguin et al., 2011
whole organism myf5 expression increased amount, abnormal WT + MO3-ctcf Fig. 6 from Delgado-Olguin et al., 2011
whole organism tp53 expression increased amount, abnormal WT + MO3-ctcf Fig. 6 from Carmona-Aldana et al., 2018
whole organism bbc3 expression increased amount, abnormal WT + MO3-ctcf Fig. 6 from Carmona-Aldana et al., 2018
whole organism morphology, abnormal WT + MO3-ctcf Fig. 5 with image from Carmona-Aldana et al., 2018
Phenotype of all Fish created by or utilizing MO3-ctcf
Phenotype Fish Conditions Figures
notochord morphology, abnormal WT + MO3-ctcf standard conditions Fig. 4 with imageFig. 5 with image from Carmona-Aldana et al., 2018
somite morphology, abnormal WT + MO3-ctcf standard conditions Fig. 4 with imageFig. 5 with image from Carmona-Aldana et al., 2018
Fig. 6 from Delgado-Olguin et al., 2011
whole organism myf5 expression increased amount, abnormal WT + MO3-ctcf standard conditions Fig. 6 from Delgado-Olguin et al., 2011
whole organism bbc3 expression increased amount, abnormal WT + MO3-ctcf standard conditions Fig. 6 from Carmona-Aldana et al., 2018
dorsal oblique extraocular muscle myog expression absent, abnormal WT + MO3-ctcf standard conditions Fig. 5 from Delgado-Olguin et al., 2011
whole organism myod1 expression decreased amount, abnormal WT + MO3-ctcf standard conditions Fig. 6 from Delgado-Olguin et al., 2011
somite shape, abnormal WT + MO3-ctcf standard conditions Fig. 5 from Delgado-Olguin et al., 2011
muscle cell decreased amount, abnormal WT + MO3-ctcf standard conditions Fig. 5 from Delgado-Olguin et al., 2011
levator arcus palatini myog expression absent, abnormal WT + MO3-ctcf standard conditions Fig. 5 from Delgado-Olguin et al., 2011
post-vent region shape, abnormal WT + MO3-ctcf standard conditions Fig. 5 with image from Carmona-Aldana et al., 2018
somite disorganized, abnormal WT + MO3-ctcf standard conditions Fig. 5 from Delgado-Olguin et al., 2011
muscle myog expression decreased amount, abnormal WT + MO3-ctcf standard conditions Fig. 6 from Delgado-Olguin et al., 2011
whole organism ctcf expression decreased amount, abnormal WT + MO3-ctcf standard conditions Fig. 3 from Carmona-Aldana et al., 2018
skeletal muscle tissue development disrupted, abnormal WT + MO3-ctcf standard conditions Fig. 5Fig. 6 from Delgado-Olguin et al., 2011
whole organism morphology, abnormal WT + MO3-ctcf standard conditions Fig. 5 with image from Carmona-Aldana et al., 2018
hypaxial myotome region myog expression absent, abnormal WT + MO3-ctcf standard conditions Fig. 5 from Delgado-Olguin et al., 2011
post-vent region increased curvature, abnormal WT + MO3-ctcf standard conditions Fig. 5 from Delgado-Olguin et al., 2011
whole organism decreased length, abnormal WT + MO3-ctcf standard conditions Fig. 4 with imageFig. 5 with image from Carmona-Aldana et al., 2018
Fig. 6 from Delgado-Olguin et al., 2011
brain segmentation decreased process quality, abnormal WT + MO3-ctcf standard conditions Fig. 4 with imageFig. 5 with image from Carmona-Aldana et al., 2018
hindbrain morphology, abnormal WT + MO3-ctcf standard conditions Fig. 4 with imageFig. 5 with image from Carmona-Aldana et al., 2018
head shape, abnormal WT + MO3-ctcf standard conditions Fig. 5 with image from Carmona-Aldana et al., 2018
pectoral fin musculature myog expression decreased amount, abnormal WT + MO3-ctcf standard conditions Fig. 5 from Delgado-Olguin et al., 2011
post-vent region decreased size, abnormal WT + MO3-ctcf standard conditions Fig. 4 with imageFig. 5 with image from Carmona-Aldana et al., 2018
whole organism myog expression decreased amount, abnormal WT + MO3-ctcf standard conditions Fig. 6 from Delgado-Olguin et al., 2011
somitogenesis disrupted, abnormal WT + MO3-ctcf standard conditions Fig. 5 from Delgado-Olguin et al., 2011
anatomical structure myog expression decreased amount, abnormal WT + MO3-ctcf standard conditions Fig. 5 from Delgado-Olguin et al., 2011
forebrain morphology, abnormal WT + MO3-ctcf standard conditions Fig. 4 with imageFig. 5 with image from Carmona-Aldana et al., 2018
ventral mandibular arch myog expression absent, abnormal WT + MO3-ctcf standard conditions Fig. 5 from Delgado-Olguin et al., 2011
ventral transverse myog expression absent, abnormal WT + MO3-ctcf standard conditions Fig. 5 from Delgado-Olguin et al., 2011
whole organism tp53 expression increased amount, abnormal WT + MO3-ctcf standard conditions Fig. 6 from Carmona-Aldana et al., 2018
eye hypoplastic, abnormal WT + MO3-ctcf standard conditions Fig. 4 with imageFig. 5 with image from Carmona-Aldana et al., 2018
lateral rectus myog expression absent, abnormal WT + MO3-ctcf standard conditions Fig. 5 from Delgado-Olguin et al., 2011
midbrain morphology, abnormal WT + MO3-ctcf standard conditions Fig. 4 with imageFig. 5 with image from Carmona-Aldana et al., 2018
Citations