Morpholino

MO2-scrt2

ID
ZDB-MRPHLNO-110808-4
Name
MO2-scrt2
Previous Names
None
Target
Sequence
5' - CGCACCAGAAAATCCTTCACATCGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Targets 5'UTR.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-scrt2
No data available
Phenotype
Phenotype resulting from MO2-scrt2
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal WT + MO2-scrt2 Fig. 2Fig. 3Fig. 7 from Rodríguez-Aznar et al., 2011
cell proliferation in hindbrain ventricular zone increased occurrence, abnormal WT + MO2-scrt2 Fig. 7 from Rodríguez-Aznar et al., 2011
neuron differentiation increased occurrence, abnormal knu3Tg + MO2-scrt2 Fig. 2 from Rodríguez-Aznar et al., 2013
primary neuron proliferative, abnormal WT + MO2-scrt2 Fig. 4Fig. 5Fig. 7 from Rodríguez-Aznar et al., 2013
proliferative region mislocalised, abnormal WT + MO2-scrt2 Fig. 7 from Rodríguez-Aznar et al., 2013
re-entry into mitotic cell cycle increased occurrence, abnormal knu3Tg + MO2-scrt2 Fig. 4Fig. 7 from Rodríguez-Aznar et al., 2013
regulation of cyclin-dependent protein serine/threonine kinase activity decreased process quality, abnormal WT + MO2-scrt2 Fig. 5 from Rodríguez-Aznar et al., 2013
regulation of neural precursor cell proliferation decreased process quality, abnormal in1Tg; knu3Tg + MO2-scrt2 Fig. 4Fig. 7 from Rodríguez-Aznar et al., 2013
spinal cord has extra parts of type neuron, abnormal WT + MO2-scrt2 + MO4-tp53 Fig. 2 from Rodríguez-Aznar et al., 2013
spinal cord has extra parts of type primary interneuron, abnormal WT + MO2-scrt2 Fig. 3 from Rodríguez-Aznar et al., 2013
spinal cord has extra parts of type primary motor neuron, abnormal WT + MO2-scrt2 Fig. 3Fig. 7 from Rodríguez-Aznar et al., 2013
whole organism decreased length, abnormal WT + MO2-scrt2 Fig. 2 from Rodríguez-Aznar et al., 2011
whole organism opaque, abnormal WT + MO2-scrt2 Fig. 2 from Rodríguez-Aznar et al., 2011
Phenotype of all Fish created by or utilizing MO2-scrt2
Phenotype Fish Conditions Figures
cell proliferation in hindbrain ventricular zone increased occurrence, abnormal WT + MO2-scrt2 standard conditions Fig. 7 from Rodríguez-Aznar et al., 2011
whole organism opaque, abnormal WT + MO2-scrt2 standard conditions Fig. 2 from Rodríguez-Aznar et al., 2011
whole organism decreased length, abnormal WT + MO2-scrt2 standard conditions Fig. 2 from Rodríguez-Aznar et al., 2011
proliferative region mislocalised, abnormal WT + MO2-scrt2 standard conditions Fig. 7 from Rodríguez-Aznar et al., 2013
neuron differentiation increased occurrence, abnormal WT + MO2-scrt2 standard conditions Fig. 2 from Rodríguez-Aznar et al., 2013
spinal cord has extra parts of type neuron, abnormal WT + MO2-scrt2 standard conditions Fig. 2 from Rodríguez-Aznar et al., 2013
regulation of cyclin-dependent protein serine/threonine kinase activity decreased process quality, abnormal WT + MO2-scrt2 standard conditions Fig. 5 from Rodríguez-Aznar et al., 2013
spinal cord has extra parts of type primary motor neuron, abnormal WT + MO2-scrt2 standard conditions Fig. 3Fig. 7 from Rodríguez-Aznar et al., 2013
spinal cord has extra parts of type primary interneuron, abnormal WT + MO2-scrt2 standard conditions Fig. 3 from Rodríguez-Aznar et al., 2013
apoptotic process increased occurrence, abnormal WT + MO2-scrt2 standard conditions Fig. 2Fig. 3Fig. 7 from Rodríguez-Aznar et al., 2011
regulation of neural precursor cell proliferation decreased process quality, abnormal WT + MO2-scrt2 standard conditions Fig. 4Fig. 7 from Rodríguez-Aznar et al., 2013
primary neuron proliferative, abnormal WT + MO2-scrt2 standard conditions Fig. 4Fig. 5Fig. 7 from Rodríguez-Aznar et al., 2013
re-entry into mitotic cell cycle increased occurrence, abnormal WT + MO2-scrt2 standard conditions Fig. 4Fig. 7 from Rodríguez-Aznar et al., 2013
spinal cord has extra parts of type neuron, abnormal WT + MO2-scrt2 + MO4-tp53 standard conditions Fig. 2 from Rodríguez-Aznar et al., 2013
neuron differentiation increased occurrence, abnormal WT + MO2-scrt2 + MO4-tp53 standard conditions Fig. 2 from Rodríguez-Aznar et al., 2013
spinal cord has extra parts of type neuron, abnormal knu3Tg + MO2-scrt2 standard conditions Fig. 2 from Rodríguez-Aznar et al., 2013
proliferative region mislocalised, abnormal knu3Tg + MO2-scrt2 standard conditions Fig. 7 from Rodríguez-Aznar et al., 2013
neuron differentiation increased occurrence, abnormal knu3Tg + MO2-scrt2 standard conditions Fig. 2 from Rodríguez-Aznar et al., 2013
re-entry into mitotic cell cycle increased occurrence, abnormal knu3Tg + MO2-scrt2 standard conditions Fig. 4Fig. 7 from Rodríguez-Aznar et al., 2013
regulation of neural precursor cell proliferation decreased process quality, abnormal knu3Tg + MO2-scrt2 standard conditions Fig. 4Fig. 7 from Rodríguez-Aznar et al., 2013
primary neuron proliferative, abnormal knu3Tg + MO2-scrt2 standard conditions Fig. 4Fig. 7 from Rodríguez-Aznar et al., 2013
regulation of neural precursor cell proliferation decreased process quality, abnormal in1Tg; knu3Tg + MO2-scrt2 standard conditions Fig. 4 from Rodríguez-Aznar et al., 2013
primary neuron proliferative, abnormal in1Tg; knu3Tg + MO2-scrt2 standard conditions Fig. 4 from Rodríguez-Aznar et al., 2013
re-entry into mitotic cell cycle increased occurrence, abnormal in1Tg; knu3Tg + MO2-scrt2 standard conditions Fig. 4 from Rodríguez-Aznar et al., 2013
Citations