Morpholino

MO3-nphp4

ID
ZDB-MRPHLNO-110908-2
Name
MO3-nphp4
Previous Names
  • nphp4 Ex1 (1)
Target
Sequence
5' - ATTTATTCCCCATCCACCTGTGTCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-nphp4
No data available
Phenotype
Phenotype resulting from MO3-nphp4
Phenotype Fish Figures
brain hydrophilic, abnormal WT + MO3-nphp4 + MO4-tp53 Fig. 2 from Slanchev et al., 2011
cloaca development disrupted, abnormal WT + MO3-nphp4 + MO4-tp53 Fig. 4Fig. 5 from Slanchev et al., 2011
cloacal chamber distended, abnormal zf106Tg + MO3-nphp4 + MO4-tp53 Fig. 2 from Slanchev et al., 2011
distal tubule morphogenesis disrupted, abnormal zf106Tg + MO3-nphp4 + MO4-tp53 Fig. 5 from Slanchev et al., 2011
heart looping disrupted, abnormal WT + MO3-nphp4 + MO4-tp53 Fig. 3 from Slanchev et al., 2011
heart tube centered, abnormal li1Tg + MO3-nphp4 + MO4-tp53 Fig. 3Fig. 6 from Slanchev et al., 2011
heart tube left side of axis, abnormal li1Tg + MO3-nphp4 + MO4-tp53 Fig. 3Fig. 6 from Slanchev et al., 2011
Kupffer's vesicle decreased size, abnormal WT + MO3-nphp4 + MO4-tp53 Fig. 3Fig. S2 from Slanchev et al., 2011
Kupffer's vesicle cilium decreased amount, abnormal WT + MO3-nphp4 + MO4-tp53 Fig. 3 from Slanchev et al., 2011
pericardium edematous, abnormal WT + MO3-nphp4 + MO4-tp53 Fig. 2 from Slanchev et al., 2011
positive regulation of apoptotic process disrupted, abnormal WT + MO3-nphp4 + MO4-tp53 Fig. 4 from Slanchev et al., 2011
posterior pronephric duct bent, abnormal zf106Tg + MO3-nphp4 + MO4-tp53 Fig. 5 from Slanchev et al., 2011
proctodeum atretic, abnormal zf106Tg + MO3-nphp4 + MO4-tp53 Fig. 2 from Slanchev et al., 2011
proctodeum anatomical region unfused from cloacal chamber, abnormal WT + MO3-nphp4 + MO4-tp53 Fig. 4Fig. 5 from Slanchev et al., 2011
pronephric distal late tubule cell migration disrupted, abnormal zf106Tg + MO3-nphp4 + MO4-tp53 Fig. 5 from Slanchev et al., 2011
pronephric duct decreased length, abnormal zf106Tg + MO3-nphp4 + MO4-tp53 Fig. 8 from Slanchev et al., 2011
pronephric duct dilated, abnormal zf106Tg + MO3-nphp4 + MO4-tp53 Fig. 2 from Slanchev et al., 2011
pronephric duct cilium curved, abnormal WT + MO3-nphp4 + MO4-tp53 Fig. 3 from Slanchev et al., 2011
pronephric duct cilium decreased length, abnormal WT + MO3-nphp4 + MO4-tp53 Fig. 3 from Slanchev et al., 2011
pronephric duct cilium disoriented, abnormal WT + MO3-nphp4 + MO4-tp53 Fig. 3 from Slanchev et al., 2011
pronephric duct opening absent, abnormal zf106Tg + MO3-nphp4 + MO4-tp53 Fig. 5 from Slanchev et al., 2011
pronephric glomerulus cystic, abnormal li1Tg + MO3-nphp4 + MO4-tp53 Fig. 2 from Slanchev et al., 2011
pronephros cystic, abnormal WT + MO3-nphp4 + MO4-tp53 Fig. 2 from Slanchev et al., 2011
whole organism curved ventral, abnormal WT + MO3-nphp4 + MO4-tp53 Fig. 2Fig. 6 from Slanchev et al., 2011
Phenotype of all Fish created by or utilizing MO3-nphp4
Phenotype Fish Conditions Figures
heart tube centered, abnormal WT + MO3-nphp4 + MO4-tp53 standard conditions Fig. 3 from Slanchev et al., 2011
Kupffer's vesicle decreased size, abnormal WT + MO3-nphp4 + MO4-tp53 standard conditions Fig. 3Fig. S2 from Slanchev et al., 2011
heart tube left side of axis, abnormal WT + MO3-nphp4 + MO4-tp53 standard conditions Fig. 3 from Slanchev et al., 2011
Kupffer's vesicle cilium decreased amount, abnormal WT + MO3-nphp4 + MO4-tp53 standard conditions Fig. 3 from Slanchev et al., 2011
pronephric duct cilium decreased length, abnormal WT + MO3-nphp4 + MO4-tp53 standard conditions Fig. 3 from Slanchev et al., 2011
heart looping disrupted, abnormal WT + MO3-nphp4 + MO4-tp53 standard conditions Fig. 3 from Slanchev et al., 2011
brain hydrophilic, abnormal WT + MO3-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
pronephric duct dilated, abnormal WT + MO3-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
pronephric duct cilium disoriented, abnormal WT + MO3-nphp4 + MO4-tp53 standard conditions Fig. 3 from Slanchev et al., 2011
pericardium edematous, abnormal WT + MO3-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
positive regulation of apoptotic process disrupted, abnormal WT + MO3-nphp4 + MO4-tp53 standard conditions Fig. 4 from Slanchev et al., 2011
proctodeum anatomical region unfused from cloacal chamber, abnormal WT + MO3-nphp4 + MO4-tp53 standard conditions Fig. 4 from Slanchev et al., 2011
cloaca development disrupted, abnormal WT + MO3-nphp4 + MO4-tp53 standard conditions Fig. 4 from Slanchev et al., 2011
pronephric duct cilium curved, abnormal WT + MO3-nphp4 + MO4-tp53 standard conditions Fig. 3 from Slanchev et al., 2011
pronephros cystic, abnormal WT + MO3-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
whole organism curved ventral, abnormal WT + MO3-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
heart tube centered, abnormal li1Tg + MO3-nphp4 + MO4-tp53 standard conditions Fig. 6 from Slanchev et al., 2011
pronephric glomerulus cystic, abnormal li1Tg + MO3-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
heart tube left side of axis, abnormal li1Tg + MO3-nphp4 + MO4-tp53 standard conditions Fig. 6 from Slanchev et al., 2011
whole organism curved ventral, abnormal li1Tg + MO3-nphp4 + MO4-tp53 standard conditions Fig. 6 from Slanchev et al., 2011
pronephric duct dilated, abnormal zf106Tg + MO3-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
posterior pronephric duct bent, abnormal zf106Tg + MO3-nphp4 + MO4-tp53 standard conditions Fig. 5 from Slanchev et al., 2011
proctodeum atretic, abnormal zf106Tg + MO3-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
pronephric duct opening absent, abnormal zf106Tg + MO3-nphp4 + MO4-tp53 standard conditions Fig. 5 from Slanchev et al., 2011
pronephric duct decreased length, abnormal zf106Tg + MO3-nphp4 + MO4-tp53 standard conditions Fig. 8 from Slanchev et al., 2011
proctodeum anatomical region unfused from cloacal chamber, abnormal zf106Tg + MO3-nphp4 + MO4-tp53 standard conditions Fig. 5 from Slanchev et al., 2011
distal tubule morphogenesis disrupted, abnormal zf106Tg + MO3-nphp4 + MO4-tp53 standard conditions Fig. 5 from Slanchev et al., 2011
pronephric distal late tubule cell migration disrupted, abnormal zf106Tg + MO3-nphp4 + MO4-tp53 standard conditions Fig. 5 from Slanchev et al., 2011
cloacal chamber distended, abnormal zf106Tg + MO3-nphp4 + MO4-tp53 standard conditions Fig. 2 from Slanchev et al., 2011
cloaca development disrupted, abnormal zf106Tg + MO3-nphp4 + MO4-tp53 standard conditions Fig. 5 from Slanchev et al., 2011
pronephric duct dilated, abnormal li1Tg + MO1-nphp1 + MO3-nphp4 + MO4-tp53 standard conditions Fig. 6 from Slanchev et al., 2011
whole organism curved ventral, abnormal li1Tg + MO1-nphp1 + MO3-nphp4 + MO4-tp53 standard conditions Fig. 6 from Slanchev et al., 2011
pericardium edematous, abnormal li1Tg + MO1-nphp1 + MO3-nphp4 + MO4-tp53 standard conditions Fig. 6 from Slanchev et al., 2011
pronephric duct cilium disoriented, abnormal li1Tg + MO1-nphp1 + MO3-nphp4 + MO4-tp53 standard conditions Fig. 6 from Slanchev et al., 2011
heart tube left side of axis, abnormal li1Tg + MO1-nphp1 + MO3-nphp4 + MO4-tp53 standard conditions Fig. 6 from Slanchev et al., 2011
heart tube centered, abnormal li1Tg + MO1-nphp1 + MO3-nphp4 + MO4-tp53 standard conditions Fig. 6 from Slanchev et al., 2011
pronephros cystic, abnormal li1Tg + MO1-nphp1 + MO3-nphp4 + MO4-tp53 standard conditions Fig. 6 from Slanchev et al., 2011
pronephric duct decreased length, abnormal zf106Tg + MO2-pard6gb + MO3-nphp4 + MO4-tp53 standard conditions Fig. 8 from Slanchev et al., 2011
pronephric distal late tubule cell migration disrupted, abnormal zf106Tg + MO2-pard6gb + MO3-nphp4 + MO4-tp53 standard conditions Fig. 8 from Slanchev et al., 2011
proctodeum anatomical region unfused from cloacal chamber, abnormal zf106Tg + MO2-pard6gb + MO3-nphp4 + MO4-tp53 standard conditions Fig. 8 from Slanchev et al., 2011
cloacal chamber distended, abnormal zf106Tg + MO2-pard6gb + MO3-nphp4 + MO4-tp53 standard conditions Fig. 8 from Slanchev et al., 2011
cloaca development disrupted, abnormal zf106Tg + MO2-pard6gb + MO3-nphp4 + MO4-tp53 standard conditions Fig. 8 from Slanchev et al., 2011
distal tubule morphogenesis disrupted, abnormal zf106Tg + MO2-pard6gb + MO3-nphp4 + MO4-tp53 standard conditions Fig. 8 from Slanchev et al., 2011
Citations