Morpholino

MO2-vgll2a

ID
ZDB-MRPHLNO-110919-1
Name
MO2-vgll2a
Previous Names
  • vgll2a ATG MO (1)
Target
Sequence
5' - CATCCAAGCAGCTCATGGCGAAGAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-vgll2a
No data available
Phenotype
Phenotype resulting from MO2-vgll2a
Phenotype Fish Figures
cell death increased occurrence, abnormal WT + MO2-vgll2a Fig. 5 with image from Johnson et al., 2011
ceratohyal cartilage hypoplastic, abnormal WT + MO2-vgll2a Fig. 2 with image from Johnson et al., 2011
cranial neural crest cell decreased amount, abnormal WT + MO2-vgll2a text only from Johnson et al., 2011
embryonic cranial skeleton morphogenesis disrupted, abnormal WT + MO2-vgll2a Fig. 2 with image from Johnson et al., 2011
ethmoid cartilage decreased size, abnormal WT + MO2-vgll2a Fig. 2 with image from Johnson et al., 2011
hyosymplectic cartilage hypoplastic, abnormal WT + MO2-vgll2a Fig. 2 with image from Johnson et al., 2011
Meckel's cartilage hypoplastic, abnormal WT + MO2-vgll2a Fig. 2 with image from Johnson et al., 2011
palatoquadrate cartilage hypoplastic, abnormal WT + MO2-vgll2a Fig. 2 with image from Johnson et al., 2011
pharyngeal arch morphology, abnormal WT + MO2-vgll2a Fig. 5 with image from Johnson et al., 2011
pharyngeal arch 3-7 lacks all parts of type ceratobranchial 5 cartilage, abnormal WT + MO2-vgll2a Fig. 2 with image from Johnson et al., 2011
pharyngeal arch 3-7 lacks all parts of type ceratobranchial 2 cartilage, abnormal WT + MO2-vgll2a Fig. 2 with image from Johnson et al., 2011
pharyngeal arch 3-7 lacks all parts of type ceratobranchial 1 cartilage, abnormal WT + MO2-vgll2a Fig. 2 with image from Johnson et al., 2011
pharyngeal arch 3-7 lacks all parts of type ceratobranchial 4 cartilage, abnormal WT + MO2-vgll2a Fig. 2 with image from Johnson et al., 2011
pharyngeal arch 3-7 lacks all parts of type ceratobranchial 3 cartilage, abnormal WT + MO2-vgll2a Fig. 2 with image from Johnson et al., 2011
pharyngeal epithelium disorganized, abnormal WT + MO2-vgll2a Fig. 3 with image from Johnson et al., 2011
pharyngeal pouch decreased length, abnormal WT + MO2-vgll2a Fig. 3 with image from Johnson et al., 2011
pharyngeal pouch increased width, abnormal WT + MO2-vgll2a Fig. 3 with image from Johnson et al., 2011
Phenotype of all Fish created by or utilizing MO2-vgll2a
Phenotype Fish Conditions Figures
embryonic cranial skeleton morphogenesis disrupted, abnormal WT + MO2-vgll2a standard conditions Fig. 2 with image from Johnson et al., 2011
pharyngeal epithelium disorganized, abnormal WT + MO2-vgll2a standard conditions Fig. 3 with image from Johnson et al., 2011
pharyngeal arch 3-7 lacks all parts of type ceratobranchial 5 cartilage, abnormal WT + MO2-vgll2a standard conditions Fig. 2 with image from Johnson et al., 2011
ethmoid cartilage decreased size, abnormal WT + MO2-vgll2a standard conditions Fig. 2 with image from Johnson et al., 2011
ceratohyal cartilage hypoplastic, abnormal WT + MO2-vgll2a standard conditions Fig. 2 with image from Johnson et al., 2011
pharyngeal arch 3-7 lacks all parts of type ceratobranchial 1 cartilage, abnormal WT + MO2-vgll2a standard conditions Fig. 2 with image from Johnson et al., 2011
pharyngeal arch morphology, abnormal WT + MO2-vgll2a standard conditions Fig. 5 with image from Johnson et al., 2011
Meckel's cartilage hypoplastic, abnormal WT + MO2-vgll2a standard conditions Fig. 2 with image from Johnson et al., 2011
pharyngeal arch 3-7 lacks all parts of type ceratobranchial 4 cartilage, abnormal WT + MO2-vgll2a standard conditions Fig. 2 with image from Johnson et al., 2011
hyosymplectic cartilage hypoplastic, abnormal WT + MO2-vgll2a standard conditions Fig. 2 with image from Johnson et al., 2011
pharyngeal arch 3-7 lacks all parts of type ceratobranchial 3 cartilage, abnormal WT + MO2-vgll2a standard conditions Fig. 2 with image from Johnson et al., 2011
cell death increased occurrence, abnormal WT + MO2-vgll2a standard conditions Fig. 5 with image from Johnson et al., 2011
pharyngeal pouch increased width, abnormal WT + MO2-vgll2a standard conditions Fig. 3 with image from Johnson et al., 2011
pharyngeal arch 3-7 lacks all parts of type ceratobranchial 2 cartilage, abnormal WT + MO2-vgll2a standard conditions Fig. 2 with image from Johnson et al., 2011
palatoquadrate cartilage hypoplastic, abnormal WT + MO2-vgll2a standard conditions Fig. 2 with image from Johnson et al., 2011
pharyngeal pouch decreased length, abnormal WT + MO2-vgll2a standard conditions Fig. 3 with image from Johnson et al., 2011
cranial neural crest cell decreased amount, abnormal WT + MO2-vgll2a standard conditions text only from Johnson et al., 2011
Citations