Morpholino

MO2-ocrl

ID
ZDB-MRPHLNO-120409-1
Name
MO2-ocrl
Previous Names
  • OCRL MO1 (1)
Target
Sequence
5' - CGGAAATCCCAAATGAAGGTTCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ocrl
No data available
Phenotype
Phenotype resulting from MO2-ocrl
Phenotype Fish Figures
brain hydrocephalic, abnormal WT + MO2-ocrl Fig. 2 from Rbaibi et al., 2012
cellular response to epinephrine stimulus delayed, abnormal WT + MO2-ocrl Fig. 4 with image from Luo et al., 2013
embryo development disrupted, abnormal WT + MO2-ocrl Fig. 2 from Rbaibi et al., 2012
eye decreased size, abnormal AB/TL + MO2-ocrl Fig. S1 from Coon et al., 2012
Fig. 5Fig. S5 from Luo et al., 2012
head decreased size, abnormal AB/TL + MO2-ocrl Fig. S1 from Coon et al., 2012
Kupffer's vesicle has fewer parts of type ciliated epithelial cell cilium, abnormal AB/TU + MO2-ocrl Fig. 5 from Luo et al., 2012
Kupffer's vesicle cilium decreased length, abnormal AB/TU + MO2-ocrl Fig. 7 with image from Luo et al., 2013
Fig. S5 from Luo et al., 2012
lens decreased size, abnormal AB/TU + MO2-ocrl Fig. 5Fig. S5 from Luo et al., 2012
melanocyte decreased amount, abnormal AB/TL + MO2-ocrl Fig. S1 from Coon et al., 2012
melanocyte mislocalised, abnormal AB/TL + MO2-ocrl Fig. S1 from Coon et al., 2012
melanocyte melanosome spatial pattern, abnormal WT + MO2-ocrl Fig. 4 with image from Luo et al., 2013
melanosome localization disrupted, abnormal WT + MO2-ocrl Fig. 4 with image from Luo et al., 2013
pericardium edematous, abnormal WT + MO2-ocrl Fig. 2 from Rbaibi et al., 2012
post-vent region kinked, abnormal AB/TU + MO2-ocrl Fig. 5 from Luo et al., 2012
pronephric proximal convoluted tubule decreased length, abnormal AB + MO2-ocrl Fig. S5 from Gliozzi et al., 2019
pronephric tubule increased width, abnormal WT + MO2-ocrl Fig. 4 from Rbaibi et al., 2012
pronephric tubule cilium disorganized, abnormal WT + MO2-ocrl Fig. 4 from Rbaibi et al., 2012
pronephric tubule cilium increased length, abnormal WT + MO2-ocrl Fig. 4 from Rbaibi et al., 2012
proximal straight tubule decreased length, abnormal AB + MO2-ocrl Fig. S5 from Gliozzi et al., 2019
renal filtration disrupted, abnormal WT + MO2-ocrl Fig. 3 from Rbaibi et al., 2012
retina deformed, abnormal AB/TU + MO2-ocrl Fig. 5Fig. S5 from Luo et al., 2012
retina layer formation process quality, abnormal AB/TU + MO2-ocrl Fig. 5 from Luo et al., 2012
ventricular system distended, abnormal AB/TU + MO2-ocrl Fig. 5 from Luo et al., 2012
whole organism curled, abnormal AB/TL + MO2-ocrl Fig. S1 from Coon et al., 2012
whole organism decreased pigmentation, abnormal AB/TU + MO2-ocrl Fig. 5Fig. S5 from Luo et al., 2012
whole organism edematous, abnormal AB/TU + MO2-ocrl Fig. 5 from Luo et al., 2012
whole organism increased curvature, abnormal WT + MO2-ocrl Fig. 2 from Rbaibi et al., 2012
whole organism anterior-posterior axis asymmetrical, abnormal AB/TU + MO2-ocrl Fig. 5 from Luo et al., 2012
whole organism anterior-posterior axis decreased length, abnormal AB/TL + MO2-ocrl Fig. S1 from Coon et al., 2012
Phenotype of all Fish created by or utilizing MO2-ocrl
Phenotype Fish Conditions Figures
pronephric proximal convoluted tubule decreased length, abnormal AB + MO2-ocrl standard conditions Fig. S5 from Gliozzi et al., 2019
proximal straight tubule decreased length, abnormal AB + MO2-ocrl standard conditions Fig. S5 from Gliozzi et al., 2019
melanocyte decreased amount, abnormal AB/TL + MO2-ocrl standard conditions Fig. S1 from Coon et al., 2012
eye decreased size, abnormal AB/TL + MO2-ocrl standard conditions Fig. S1 from Coon et al., 2012
whole organism curled, abnormal AB/TL + MO2-ocrl standard conditions Fig. S1 from Coon et al., 2012
melanocyte mislocalised, abnormal AB/TL + MO2-ocrl standard conditions Fig. S1 from Coon et al., 2012
head decreased size, abnormal AB/TL + MO2-ocrl standard conditions Fig. S1 from Coon et al., 2012
whole organism anterior-posterior axis decreased length, abnormal AB/TL + MO2-ocrl standard conditions Fig. S1 from Coon et al., 2012
post-vent region kinked, abnormal AB/TU + MO2-ocrl standard conditions Fig. 5 from Luo et al., 2012
whole organism edematous, abnormal AB/TU + MO2-ocrl standard conditions Fig. 5 from Luo et al., 2012
whole organism anterior-posterior axis asymmetrical, abnormal AB/TU + MO2-ocrl standard conditions Fig. 5 from Luo et al., 2012
whole organism decreased pigmentation, abnormal AB/TU + MO2-ocrl standard conditions Fig. 5Fig. S5 from Luo et al., 2012
eye decreased size, abnormal AB/TU + MO2-ocrl standard conditions Fig. 5Fig. S5 from Luo et al., 2012
Kupffer's vesicle cilium decreased length, abnormal AB/TU + MO2-ocrl standard conditions Fig. S5 from Luo et al., 2012
retina layer formation process quality, abnormal AB/TU + MO2-ocrl standard conditions Fig. 5 from Luo et al., 2012
ventricular system distended, abnormal AB/TU + MO2-ocrl standard conditions Fig. 5 from Luo et al., 2012
lens decreased size, abnormal AB/TU + MO2-ocrl standard conditions Fig. 5Fig. S5 from Luo et al., 2012
Kupffer's vesicle has fewer parts of type ciliated epithelial cell cilium, abnormal AB/TU + MO2-ocrl standard conditions Fig. 5 from Luo et al., 2012
retina deformed, abnormal AB/TU + MO2-ocrl standard conditions Fig. 5Fig. S5 from Luo et al., 2012
renal filtration disrupted, abnormal WT + MO2-ocrl standard conditions Fig. 3 from Rbaibi et al., 2012
brain hydrocephalic, abnormal WT + MO2-ocrl standard conditions Fig. 2 from Rbaibi et al., 2012
embryo development disrupted, abnormal WT + MO2-ocrl standard conditions Fig. 2 from Rbaibi et al., 2012
cellular response to epinephrine stimulus delayed, abnormal WT + MO2-ocrl standard conditions Fig. 4 with image from Luo et al., 2013
pronephric tubule increased width, abnormal WT + MO2-ocrl standard conditions Fig. 4 from Rbaibi et al., 2012
pronephric tubule cilium disorganized, abnormal WT + MO2-ocrl standard conditions Fig. 4 from Rbaibi et al., 2012
whole organism increased curvature, abnormal WT + MO2-ocrl standard conditions Fig. 2 from Rbaibi et al., 2012
pronephric tubule cilium increased length, abnormal WT + MO2-ocrl standard conditions Fig. 4 from Rbaibi et al., 2012
melanocyte melanosome spatial pattern, abnormal WT + MO2-ocrl standard conditions Fig. 4 with image from Luo et al., 2013
pericardium edematous, abnormal WT + MO2-ocrl standard conditions Fig. 2 from Rbaibi et al., 2012
Kupffer's vesicle cilium decreased length, abnormal WT + MO2-ocrl standard conditions Fig. 7 with image from Luo et al., 2013
melanosome localization disrupted, abnormal WT + MO2-ocrl standard conditions Fig. 4 with image from Luo et al., 2013
eye decreased size, abnormal WT + MO2-inpp5b + MO2-ocrl standard conditions Fig. 6 with image from Luo et al., 2013
whole organism anterior-posterior axis asymmetrical, abnormal WT + MO2-inpp5b + MO2-ocrl standard conditions Fig. 6 with image from Luo et al., 2013
whole organism dead, abnormal WT + MO2-inpp5b + MO2-ocrl standard conditions Fig. 6 with image from Luo et al., 2013
pericardium edematous, abnormal WT + MO2-inpp5b + MO2-ocrl standard conditions Fig. 6 with image from Luo et al., 2013
Citations