Morpholino

MO4-rbm24a

ID
ZDB-MRPHLNO-121001-2
Name
MO4-rbm24a
Previous Names
  • e1i1 (1)
Target
Sequence
5' - CACAAGAGGAATACTTACAAATCCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-rbm24a
No data available
Phenotype
Phenotype resulting from MO4-rbm24a
Phenotype Fish Figures
atrium dilated, abnormal WT + MO4-rbm24a Fig. S3 from Poon et al., 2012
blood circulation disrupted, abnormal sd2Tg; y1Tg + MO4-rbm24a Fig. 3Fig. S3text only from Poon et al., 2012
cardiac muscle cell decreased size, abnormal WT + MO4-rbm24a Fig. 4 from Poon et al., 2012
cardiac muscle cell myofibril sparse, abnormal WT + MO4-rbm24a Fig. 4 from Poon et al., 2012
cardiac muscle cell sarcomere disorganized, abnormal WT + MO4-rbm24a Fig. 4 from Poon et al., 2012
cardiac muscle cell sarcomere increased length, abnormal WT + MO4-rbm24a Fig. 4 from Poon et al., 2012
cardiac muscle cell striated muscle myosin thick filament disorganized, abnormal WT + MO4-rbm24a Fig. 4 from Poon et al., 2012
cardiac muscle cell striated muscle thin filament disorganized, abnormal WT + MO4-rbm24a Fig. 4 from Poon et al., 2012
cardiac muscle cell Z disc disorganized, abnormal WT + MO4-rbm24a Fig. 4 from Poon et al., 2012
cardiac ventricle hypotrophic, abnormal WT + MO4-rbm24a Fig. S3 from Poon et al., 2012
cardiac ventricle non-contractile, abnormal sqet33mi3AEt + MO4-rbm24a text only from Poon et al., 2012
common cardinal vein decreased width, abnormal sd2Tg; y1Tg + MO4-rbm24a text only from Poon et al., 2012
heart morphology, abnormal WT + MO4-rbm24a Fig. 4Fig. S3 from Poon et al., 2012
heart contraction disrupted, abnormal sqet33mi3AEt + MO4-rbm24a text only from Poon et al., 2012
heart contraction process quality, abnormal WT + MO4-rbm24a Fig. 3 from Poon et al., 2012
pericardium edematous, abnormal WT + MO4-rbm24a Fig. S3 from Poon et al., 2012
sarcomere organization disrupted, abnormal WT + MO4-rbm24a Fig. 4 from Poon et al., 2012
whole organism viability, abnormal WT + MO4-rbm24a text only from Poon et al., 2012
yolk concave, abnormal sd2Tg; y1Tg + MO4-rbm24a Fig. 3Fig. S3 from Poon et al., 2012
Phenotype of all Fish created by or utilizing MO4-rbm24a
Phenotype Fish Conditions Figures
cardiac muscle cell decreased size, abnormal WT + MO4-rbm24a standard conditions Fig. 4 from Poon et al., 2012
pericardium edematous, abnormal WT + MO4-rbm24a standard conditions Fig. S3 from Poon et al., 2012
cardiac muscle cell striated muscle myosin thick filament disorganized, abnormal WT + MO4-rbm24a standard conditions Fig. 4 from Poon et al., 2012
cardiac muscle cell sarcomere increased length, abnormal WT + MO4-rbm24a standard conditions Fig. 4 from Poon et al., 2012
yolk concave, abnormal WT + MO4-rbm24a standard conditions Fig. S3 from Poon et al., 2012
heart morphology, abnormal WT + MO4-rbm24a standard conditions Fig. 4Fig. S3 from Poon et al., 2012
blood circulation disrupted, abnormal WT + MO4-rbm24a standard conditions Fig. S3text only from Poon et al., 2012
heart contraction process quality, abnormal WT + MO4-rbm24a standard conditions Fig. 3 from Poon et al., 2012
atrium dilated, abnormal WT + MO4-rbm24a standard conditions Fig. S3 from Poon et al., 2012
cardiac muscle cell myofibril sparse, abnormal WT + MO4-rbm24a standard conditions Fig. 4 from Poon et al., 2012
cardiac ventricle hypotrophic, abnormal WT + MO4-rbm24a standard conditions Fig. S3 from Poon et al., 2012
sarcomere organization disrupted, abnormal WT + MO4-rbm24a standard conditions Fig. 4 from Poon et al., 2012
cardiac muscle cell striated muscle thin filament disorganized, abnormal WT + MO4-rbm24a standard conditions Fig. 4 from Poon et al., 2012
cardiac muscle cell sarcomere disorganized, abnormal WT + MO4-rbm24a standard conditions Fig. 4 from Poon et al., 2012
whole organism viability, abnormal WT + MO4-rbm24a standard conditions text only from Poon et al., 2012
cardiac muscle cell Z disc disorganized, abnormal WT + MO4-rbm24a standard conditions Fig. 4 from Poon et al., 2012
heart contraction disrupted, abnormal f2Tg + MO4-rbm24a standard conditions text only from Poon et al., 2012
heart contraction disrupted, abnormal sqet33mi3AEt + MO4-rbm24a standard conditions text only from Poon et al., 2012
cardiac ventricle non-contractile, abnormal sqet33mi3AEt + MO4-rbm24a standard conditions text only from Poon et al., 2012
blood circulation disrupted, abnormal sqet33mi3AEt + MO4-rbm24a standard conditions text only from Poon et al., 2012
common cardinal vein decreased width, abnormal sd2Tg; y1Tg + MO4-rbm24a standard conditions text only from Poon et al., 2012
blood circulation disrupted, abnormal sd2Tg; y1Tg + MO4-rbm24a standard conditions Fig. 3text only from Poon et al., 2012
yolk concave, abnormal sd2Tg; y1Tg + MO4-rbm24a standard conditions Fig. 3 from Poon et al., 2012
Citations