Morpholino
MO1-ptprb
- ID
- ZDB-MRPHLNO-130128-1
- Name
- MO1-ptprb
- Previous Names
-
- zve-ptp MOa (1)
- Target
- Sequence
-
5' - TACATTCCGTTGCGTCCACCACCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ptprb
No data available
Phenotype
Phenotype resulting from MO1-ptprb
Phenotype of all Fish created by or utilizing MO1-ptprb
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| blood vessel endothelial cell has fewer parts of type blood vessel endothelial cell cell-cell junction, abnormal | AB + MO1-ptprb | standard conditions |
Fig. S5 |
Citations