Morpholino

MO1-lhx3

ID
ZDB-MRPHLNO-130401-3
Name
MO1-lhx3
Previous Names
None
Target
Sequence
5' - GTTCTAACAACATTCTGGCGATAAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-lhx3
No data available
Phenotype
Phenotype resulting from MO1-lhx3
No data available
Phenotype of all Fish created by or utilizing MO1-lhx3
Phenotype Fish Conditions Figures
primary motor neuron spinal cord motor neuron cell fate specification decreased occurrence, abnormal WT + MO1-lhx3 + MO1-lhx4 standard conditions Fig. 5 with image from Seredick et al., 2014
secondary motor neuron axon extension decreased occurrence, abnormal WT + MO1-lhx3 + MO1-lhx4 standard conditions Fig. 3 with image from Seredick et al., 2014
Kolmer-Agduhr neuron ventral spinal cord interneuron specification increased occurrence, abnormal WT + MO1-lhx3 + MO1-lhx4 standard conditions Fig. 5 with image from Seredick et al., 2014
primary motor neuron axon morphology, abnormal WT + MO1-lhx3 + MO1-lhx4 standard conditions Fig. 3 with image from Seredick et al., 2014
ventral spinal nerve has fewer parts of type CaP motoneuron axon, abnormal WT + MO1-lhx3 + MO1-lhx4 standard conditions Fig. 3 with image from Seredick et al., 2014
secondary motor neuron axon morphology, abnormal WT + MO1-lhx3 + MO1-lhx4 standard conditions Fig. 3 with image from Seredick et al., 2014
primary motor neuron axon extension decreased occurrence, abnormal WT + MO1-lhx3 + MO1-lhx4 standard conditions Fig. 3 with image from Seredick et al., 2014
primary motor neuron ventral spinal cord interneuron specification increased occurrence, abnormal WT + MO1-lhx3 + MO1-lhx4 standard conditions Fig. 5 with image from Seredick et al., 2014
ventral spinal nerve has fewer parts of type secondary motor neuron axon, abnormal WT + MO1-lhx3 + MO1-lhx4 standard conditions Fig. 3 with image from Seredick et al., 2014
ventral spinal nerve decreased diameter, abnormal WT + MO1-lhx3 + MO1-lhx4 standard conditions Fig. 3 with image from Seredick et al., 2014
swimming decreased occurrence, abnormal WT + MO1-lhx3 + MO1-lhx4 standard conditions text only from Seredick et al., 2014
spinal cord has fewer parts of type primary motor neuron, abnormal WT + MO1-lhx3 + MO1-lhx4 standard conditions Fig. 5 with image from Seredick et al., 2014
spinal cord has fewer parts of type CiD, abnormal nns1Tg + MO1-lhx3 + MO1-lhx4 standard conditions Fig. 7 with image from Seredick et al., 2014
ventral spinal cord interneuron differentiation decreased occurrence, abnormal nns1Tg + MO1-lhx3 + MO1-lhx4 standard conditions Fig. 7 with image from Seredick et al., 2014
ventral spinal cord interneuron differentiation decreased occurrence, abnormal nns5Tg + MO1-lhx3 + MO1-lhx4 standard conditions Fig. 7 with image from Seredick et al., 2014
spinal cord has fewer parts of type VeLD, abnormal nns5Tg + MO1-lhx3 + MO1-lhx4 standard conditions Fig. 7 with image from Seredick et al., 2014
Citations