Morpholino

MO1-hoxd4a

ID
ZDB-MRPHLNO-130509-3
Name
MO1-hoxd4a
Previous Names
  • MO1 (1)
Target
Sequence
5' - GTTCACTGTGAAGGACAAAATCACA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hoxd4a
No data available
Phenotype
Phenotype resulting from MO1-hoxd4a
Phenotype Fish Figures
angiogenesis disrupted, abnormal y1Tg + MO1-hoxd4a Fig. 4 with image from Amali et al., 2013
caudal vein plexus aplastic, abnormal y1Tg + MO1-hoxd4a Fig. 4 with image from Amali et al., 2013
definitive hemopoiesis disrupted, abnormal AB + MO1-hoxd4a Fig. 3 with image from Amali et al., 2013
intersegmental vessel malformed, abnormal WT + MO1-hoxd4a Fig. 1Fig. 2 from Zhang et al., 2020
nucleate erythrocyte decreased amount, abnormal hoxd4azf3363/zf3363 + MO1-hoxd4a Fig. 1Fig. 2Fig. 5Fig. 6 from Zhang et al., 2020
posterior lateral mesoderm tal1 expression decreased amount, abnormal WT + MO1-hoxd4a Fig. 1Fig. 2 from Zhang et al., 2020
posterior lateral mesoderm fli1 expression decreased amount, abnormal WT + MO1-hoxd4a Fig. 1Fig. 2 from Zhang et al., 2020
primitive hemopoiesis disrupted, abnormal AB + MO1-hoxd4a Fig. 2 with imageFig. 3 with image from Amali et al., 2013
subintestinal vein aplastic, abnormal AB + MO1-hoxd4a Fig. 4 with image from Amali et al., 2013
subintestinal venous plexus malformed, abnormal WT + MO1-hoxd4a Fig. 1Fig. 2 from Zhang et al., 2020
vasculature lacks parts or has fewer parts of type intersegmental vessel, abnormal AB + MO1-hoxd4a Fig. 4 with image from Amali et al., 2013
vasculogenesis disrupted, abnormal y1Tg + MO1-hoxd4a Fig. 4 with image from Amali et al., 2013
vertebral artery aplastic, abnormal AB + MO1-hoxd4a Fig. 4 with image from Amali et al., 2013
whole organism tal1 expression decreased amount, abnormal WT + MO1-hoxd4a Fig. 2 from Zhang et al., 2020
whole organism fli1 expression decreased amount, abnormal WT + MO1-hoxd4a Fig. 2 from Zhang et al., 2020
Phenotype of all Fish created by or utilizing MO1-hoxd4a
Phenotype Fish Conditions Figures
nucleate erythrocyte decreased amount, abnormal hoxd4azf3363/zf3363 + MO1-hoxd4a standard conditions Fig. 6 from Zhang et al., 2020
vertebral artery aplastic, abnormal AB + MO1-hoxd4a standard conditions Fig. 4 with image from Amali et al., 2013
vasculature lacks parts or has fewer parts of type intersegmental vessel, abnormal AB + MO1-hoxd4a standard conditions Fig. 4 with image from Amali et al., 2013
primitive hemopoiesis disrupted, abnormal AB + MO1-hoxd4a standard conditions Fig. 2 with imageFig. 3 with image from Amali et al., 2013
definitive hemopoiesis disrupted, abnormal AB + MO1-hoxd4a standard conditions Fig. 3 with image from Amali et al., 2013
subintestinal vein aplastic, abnormal AB + MO1-hoxd4a standard conditions Fig. 4 with image from Amali et al., 2013
whole organism tal1 expression decreased amount, abnormal WT + MO1-hoxd4a control Fig. 2 from Zhang et al., 2020
posterior lateral mesoderm fli1 expression decreased amount, abnormal WT + MO1-hoxd4a control Fig. 1Fig. 2 from Zhang et al., 2020
intersegmental vessel malformed, abnormal WT + MO1-hoxd4a control Fig. 1Fig. 2 from Zhang et al., 2020
subintestinal venous plexus malformed, abnormal WT + MO1-hoxd4a control Fig. 1Fig. 2 from Zhang et al., 2020
whole organism fli1 expression decreased amount, abnormal WT + MO1-hoxd4a control Fig. 2 from Zhang et al., 2020
posterior lateral mesoderm tal1 expression decreased amount, abnormal WT + MO1-hoxd4a control Fig. 1Fig. 2 from Zhang et al., 2020
nucleate erythrocyte decreased amount, abnormal WT + MO1-hoxd4a standard conditions Fig. 1Fig. 2Fig. 5Fig. 6 from Zhang et al., 2020
caudal vein plexus aplastic, abnormal y1Tg + MO1-hoxd4a standard conditions Fig. 4 with image from Amali et al., 2013
vasculogenesis disrupted, abnormal y1Tg + MO1-hoxd4a standard conditions Fig. 4 with image from Amali et al., 2013
angiogenesis disrupted, abnormal y1Tg + MO1-hoxd4a standard conditions Fig. 4 with image from Amali et al., 2013
Citations