Morpholino

MO2-sulf1

ID
ZDB-MRPHLNO-130805-3
Name
MO2-sulf1
Previous Names
  • splice AMO (1)
Target
Sequence
5' - ATCCTGACACACAAGACAGACAACA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-sulf1
No data available
Phenotype
Phenotype resulting from MO2-sulf1
Phenotype Fish Figures
caudal fin curved, abnormal WT + MO2-sulf1 Fig. 2 with image from Meyers et al., 2013
caudal fin increased width, abnormal WT + MO2-sulf1 Fig. 2 with image from Meyers et al., 2013
horizontal myoseptum absent, abnormal WT + MO2-sulf1 Fig. 2 with imageFig. 6 with image from Meyers et al., 2013
lateral larval melanophore stripe absent, abnormal WT + MO2-sulf1 Fig. 3 with image from Meyers et al., 2013
lateral larval melanophore stripe has fewer parts of type melanocyte, abnormal WT + MO2-sulf1 Fig. 7 with image from Meyers et al., 2013
lateral line morphology, abnormal zf106Tg + MO2-sulf1 Fig. 8 with image from Meyers et al., 2013
lateral line development process quality, abnormal zf106Tg + MO2-sulf1 Fig. 8 with image from Meyers et al., 2013
muscle cell sparse, abnormal WT + MO2-sulf1 Fig. 2 with imageFig. 6 with image from Meyers et al., 2013
muscle pioneer decreased amount, abnormal WT + MO2-sulf1 Fig. 3 with image from Meyers et al., 2013
neuromast decreased amount, abnormal zf106Tg + MO2-sulf1 Fig. 9 with image from Meyers et al., 2013
neuromast decreased size, abnormal WT + MO2-sulf1 Fig. 9 with image from Meyers et al., 2013
neuromast dispersed, abnormal zf106Tg + MO2-sulf1 Fig. 9 with image from Meyers et al., 2013
neuromast deposition decreased process quality, abnormal zf106Tg + MO2-sulf1 Fig. 9 with image from Meyers et al., 2013
neuromast primordium migration process quality, abnormal zf106Tg + MO2-sulf1 Fig. 9 with image from Meyers et al., 2013
somite decreased width, abnormal WT + MO2-sulf1 Fig. 2 with imageFig. 3 with imageFig. 7 with image from Meyers et al., 2013
somite has fewer parts of type fast muscle cell, abnormal WT + MO2-sulf1 Fig. 5 with image from Meyers et al., 2013
somite has fewer parts of type muscle pioneer, abnormal WT + MO2-sulf1 Fig. 5 with image from Meyers et al., 2013
somite obtuse angle to somite, abnormal WT + MO2-sulf1 Fig. 2 with imageFig. 3 with imageFig. 7 with image from Meyers et al., 2013
somite shape, abnormal WT + MO2-sulf1 Fig. 2 with imageFig. 4 with image from Meyers et al., 2013
somite tight, abnormal WT + MO2-sulf1 Fig. 2 with image from Meyers et al., 2013
Phenotype of all Fish created by or utilizing MO2-sulf1
Phenotype Fish Conditions Figures
lateral larval melanophore stripe absent, abnormal WT + MO2-sulf1 standard conditions Fig. 3 with image from Meyers et al., 2013
somite decreased width, abnormal WT + MO2-sulf1 standard conditions Fig. 2 with imageFig. 3 with imageFig. 7 with image from Meyers et al., 2013
caudal fin increased width, abnormal WT + MO2-sulf1 standard conditions Fig. 2 with image from Meyers et al., 2013
caudal fin curved, abnormal WT + MO2-sulf1 standard conditions Fig. 2 with image from Meyers et al., 2013
muscle pioneer decreased amount, abnormal WT + MO2-sulf1 standard conditions Fig. 3 with image from Meyers et al., 2013
neuromast decreased size, abnormal WT + MO2-sulf1 standard conditions Fig. 9 with image from Meyers et al., 2013
somite shape, abnormal WT + MO2-sulf1 standard conditions Fig. 2 with imageFig. 4 with image from Meyers et al., 2013
muscle cell sparse, abnormal WT + MO2-sulf1 standard conditions Fig. 2 with imageFig. 6 with image from Meyers et al., 2013
somite has fewer parts of type muscle pioneer, abnormal WT + MO2-sulf1 standard conditions Fig. 5 with image from Meyers et al., 2013
somite obtuse angle to somite, abnormal WT + MO2-sulf1 standard conditions Fig. 2 with imageFig. 3 with imageFig. 7 with image from Meyers et al., 2013
horizontal myoseptum absent, abnormal WT + MO2-sulf1 standard conditions Fig. 2 with imageFig. 6 with image from Meyers et al., 2013
lateral larval melanophore stripe has fewer parts of type melanocyte, abnormal WT + MO2-sulf1 standard conditions Fig. 7 with image from Meyers et al., 2013
somite has fewer parts of type fast muscle cell, abnormal WT + MO2-sulf1 standard conditions Fig. 5 with image from Meyers et al., 2013
somite tight, abnormal WT + MO2-sulf1 standard conditions Fig. 2 with image from Meyers et al., 2013
lateral line morphology, abnormal zf106Tg + MO2-sulf1 standard conditions Fig. 8 with image from Meyers et al., 2013
neuromast decreased amount, abnormal zf106Tg + MO2-sulf1 standard conditions Fig. 9 with image from Meyers et al., 2013
lateral line development process quality, abnormal zf106Tg + MO2-sulf1 standard conditions Fig. 8 with image from Meyers et al., 2013
neuromast dispersed, abnormal zf106Tg + MO2-sulf1 standard conditions Fig. 9 with image from Meyers et al., 2013
neuromast deposition decreased process quality, abnormal zf106Tg + MO2-sulf1 standard conditions Fig. 9 with image from Meyers et al., 2013
neuromast primordium migration process quality, abnormal zf106Tg + MO2-sulf1 standard conditions Fig. 9 with image from Meyers et al., 2013
Citations