Morpholino

MO3-sema3e

ID
ZDB-MRPHLNO-130827-1
Name
MO3-sema3e
Previous Names
  • exon 5, sema3E MO1 (1)
Target
Sequence
5' - TTGTAGAGATGAACACTTACGGTAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-sema3e
No data available
Phenotype
Phenotype resulting from MO3-sema3e
Phenotype Fish Figures
auditory capsule absent, abnormal WT + MO3-sema3e Fig. 2 from Liu et al., 2019
branchiomotor neuron mislocalised, abnormal rw0Tg + MO3-sema3e Fig. 2 from Liu et al., 2019
ceratobranchial cartilage absent, abnormal WT + MO3-sema3e Fig. 2 from Liu et al., 2019
cranial nerve X axon collateral decreased length, abnormal rw0Tg + MO3-sema3e Fig. 2 from Liu et al., 2019
eye decreased size, abnormal WT + MO3-sema3e Fig. 2 from Liu et al., 2019
head flattened, abnormal WT + MO3-sema3e Fig. 2 from Liu et al., 2019
hindbrain cranial neural crest cell distributed, abnormal rw0Tg + MO3-sema3e Fig. 4 from Liu et al., 2019
hindbrain cranial neural crest cell mislocalised, abnormal rw0Tg + MO3-sema3e Fig. 4 from Liu et al., 2019
hindbrain migratory neural crest cell dlx2a expression decreased amount, abnormal WT + MO3-sema3e Fig. 3 from Liu et al., 2019
hindbrain migratory neural crest cell hand2 expression decreased amount, abnormal WT + MO3-sema3e Fig. 3 from Liu et al., 2019
hindbrain migratory neural crest cell mislocalised, abnormal WT + MO3-sema3e Fig. 3 from Liu et al., 2019
hindbrain migratory neural crest cell crestin expression mislocalised, abnormal WT + MO3-sema3e Fig. 3 from Liu et al., 2019
hindbrain migratory neural crest cell sox10 expression mislocalised, abnormal WT + MO3-sema3e Fig. 3 from Liu et al., 2019
otolith mislocalised, abnormal WT + MO3-sema3e Fig. 2 from Liu et al., 2019
otolith organ altered number of otolith, abnormal WT + MO3-sema3e Fig. 2 from Liu et al., 2019
pharyngeal arch neural crest cell hand2 expression decreased amount, abnormal WT + MO3-sema3e Fig. 3 from Liu et al., 2019
pharyngeal arch neural crest cell dlx2a expression decreased amount, abnormal WT + MO3-sema3e Fig. 3 from Liu et al., 2019
Phenotype of all Fish created by or utilizing MO3-sema3e
Phenotype Fish Conditions Figures
pharyngeal arch neural crest cell hand2 expression decreased amount, abnormal WT + MO3-sema3e standard conditions Fig. 3 from Liu et al., 2019
hindbrain migratory neural crest cell sox10 expression mislocalised, abnormal WT + MO3-sema3e standard conditions Fig. 3 from Liu et al., 2019
auditory capsule absent, abnormal WT + MO3-sema3e standard conditions Fig. 2 from Liu et al., 2019
hindbrain migratory neural crest cell crestin expression mislocalised, abnormal WT + MO3-sema3e standard conditions Fig. 3 from Liu et al., 2019
hindbrain migratory neural crest cell hand2 expression decreased amount, abnormal WT + MO3-sema3e standard conditions Fig. 3 from Liu et al., 2019
eye decreased size, abnormal WT + MO3-sema3e standard conditions Fig. 2 from Liu et al., 2019
ceratobranchial cartilage absent, abnormal WT + MO3-sema3e standard conditions Fig. 2 from Liu et al., 2019
otolith organ altered number of otolith, abnormal WT + MO3-sema3e standard conditions Fig. 2 from Liu et al., 2019
hindbrain migratory neural crest cell dlx2a expression decreased amount, abnormal WT + MO3-sema3e standard conditions Fig. 3 from Liu et al., 2019
pharyngeal arch neural crest cell dlx2a expression decreased amount, abnormal WT + MO3-sema3e standard conditions Fig. 3 from Liu et al., 2019
hindbrain migratory neural crest cell mislocalised, abnormal WT + MO3-sema3e standard conditions Fig. 3 from Liu et al., 2019
head flattened, abnormal WT + MO3-sema3e standard conditions Fig. 2 from Liu et al., 2019
otolith mislocalised, abnormal WT + MO3-sema3e standard conditions Fig. 2 from Liu et al., 2019
branchiomotor neuron mislocalised, abnormal rw0Tg + MO3-sema3e standard conditions Fig. 2 from Liu et al., 2019
hindbrain cranial neural crest cell mislocalised, abnormal rw0Tg + MO3-sema3e standard conditions Fig. 4 from Liu et al., 2019
hindbrain cranial neural crest cell distributed, abnormal rw0Tg + MO3-sema3e standard conditions Fig. 4 from Liu et al., 2019
cranial nerve X axon collateral decreased length, abnormal rw0Tg + MO3-sema3e standard conditions Fig. 2 from Liu et al., 2019
retina axon ipsilateral to optic tectum, abnormal AB + MO1-plxnb3 + MO3-sema3e control FIGURE 3 with image from Liu et al., 2024
Citations