Morpholino

MO1-gmppb

ID
ZDB-MRPHLNO-130828-1
Name
MO1-gmppb
Previous Names
None
Target
Sequence
5' - GGACCAGCTGAAAACAGAAACAGAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
intron 4 - exon 5 Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gmppb
No data available
Phenotype
Phenotype resulting from MO1-gmppb
Phenotype Fish Figures
CaP motoneuron axon decreased length, abnormal ml2Tg + MO1-gmppb Fig. 3 with imageFig. 4 with image from Liu et al., 2021
Fig. 7 from Zheng et al., 2021
eye decreased size, abnormal WT + MO1-gmppb Fig. 6Fig. S11 from Carss et al., 2013
multicellular organismal locomotion decreased process quality, abnormal AB + MO1-gmppb Fig. 3 with image from Liu et al., 2021
muscle sarcolemma damaged, abnormal WT + MO1-gmppb Fig. 6 from Carss et al., 2013
myoseptum damaged, abnormal WT + MO1-gmppb Fig. 6Fig. S12 from Carss et al., 2013
myoseptum increased width, abnormal WT + MO1-gmppb Fig. S12 from Carss et al., 2013
nervous system EGFP expression decreased amount, abnormal knu3Tg + MO1-gmppb Fig. 3 with image from Liu et al., 2021
obsolete protein glycosylation decreased occurrence, abnormal AB/TU + MO1-gmppb + MO4-tp53 Fig. Extended Data Fig. 9 from Zheng et al., 2021
obsolete protein glycosylation decreased process quality, abnormal WT + MO1-gmppb Fig. 6 from Carss et al., 2013
post-vent region bent, abnormal WT + MO1-gmppb Fig. 6 from Carss et al., 2013
skeletal muscle cell disorganized, abnormal AB + MO1-gmppb Fig. 4 with image from Liu et al., 2021
Fig. 7 from Zheng et al., 2021
Fig. 6 from Carss et al., 2013
skeletal muscle cell sparse, abnormal AB/TU + MO1-gmppb + MO4-tp53 Fig. 4 with image from Liu et al., 2021
Fig. 7 from Zheng et al., 2021
Fig. 6 from Carss et al., 2013
whole organism Ab1-gmppb labeling decreased amount, abnormal AB/TU + MO1-gmppb + MO4-tp53 Fig. 3 with image from Liu et al., 2021
Fig. Extended Data Fig. 9 from Zheng et al., 2021
whole organism sox2 expression decreased amount, abnormal AB/TU + MO1-gmppb + MO4-tp53 Fig. Extended Data Fig. 9 from Zheng et al., 2021
whole organism decreased length, abnormal WT + MO1-gmppb Fig. 6 from Carss et al., 2013
whole organism decreased mobility, abnormal WT + MO1-gmppb text only from Carss et al., 2013
whole organism decreased pigmentation, abnormal WT + MO1-gmppb Fig. 6 from Carss et al., 2013
whole organism GDP-mannose decreased amount, abnormal AB/TU + MO1-gmppb + MO4-tp53 Fig. Extended Data Fig. 9 from Zheng et al., 2021
Phenotype of all Fish created by or utilizing MO1-gmppb
Phenotype Fish Conditions Figures
whole organism Ab1-gmppb labeling decreased amount, abnormal AB + MO1-gmppb standard conditions Fig. 3 with image from Liu et al., 2021
multicellular organismal locomotion decreased process quality, abnormal AB + MO1-gmppb standard conditions Fig. 3 with image from Liu et al., 2021
skeletal muscle cell sparse, abnormal AB + MO1-gmppb standard conditions Fig. 4 with image from Liu et al., 2021
skeletal muscle cell disorganized, abnormal AB + MO1-gmppb standard conditions Fig. 4 with image from Liu et al., 2021
whole organism Ab1-gmppb labeling decreased amount, abnormal AB/TU + MO1-gmppb + MO4-tp53 standard conditions Fig. Extended Data Fig. 9 from Zheng et al., 2021
skeletal muscle cell morphology, ameliorated AB/TU + MO1-gmppb + MO4-tp53 chemical treatment by injection: GDP-mannose Fig. 7 from Zheng et al., 2021
obsolete protein glycosylation decreased occurrence, abnormal AB/TU + MO1-gmppb + MO4-tp53 standard conditions Fig. Extended Data Fig. 9 from Zheng et al., 2021
whole organism sox2 expression amount, ameliorated AB/TU + MO1-gmppb + MO4-tp53 chemical treatment by injection: GDP-mannose Fig. Extended Data Fig. 9 from Zheng et al., 2021
skeletal muscle cell sparse, abnormal AB/TU + MO1-gmppb + MO4-tp53 standard conditions Fig. 7 from Zheng et al., 2021
skeletal muscle cell disorganized, abnormal AB/TU + MO1-gmppb + MO4-tp53 standard conditions Fig. 7 from Zheng et al., 2021
whole organism GDP-mannose decreased amount, abnormal AB/TU + MO1-gmppb + MO4-tp53 standard conditions Fig. Extended Data Fig. 9 from Zheng et al., 2021
whole organism sox2 expression decreased amount, abnormal AB/TU + MO1-gmppb + MO4-tp53 standard conditions Fig. Extended Data Fig. 9 from Zheng et al., 2021
muscle sarcolemma damaged, abnormal WT + MO1-gmppb standard conditions Fig. 6 from Carss et al., 2013
whole organism decreased length, abnormal WT + MO1-gmppb standard conditions Fig. 6 from Carss et al., 2013
skeletal muscle cell disorganized, abnormal WT + MO1-gmppb standard conditions Fig. 6 from Carss et al., 2013
whole organism decreased mobility, abnormal WT + MO1-gmppb standard conditions text only from Carss et al., 2013
myoseptum increased width, abnormal WT + MO1-gmppb standard conditions Fig. S12 from Carss et al., 2013
myoseptum damaged, abnormal WT + MO1-gmppb standard conditions Fig. 6Fig. S12 from Carss et al., 2013
skeletal muscle cell sparse, abnormal WT + MO1-gmppb standard conditions Fig. 6 from Carss et al., 2013
post-vent region bent, abnormal WT + MO1-gmppb standard conditions Fig. 6 from Carss et al., 2013
whole organism decreased pigmentation, abnormal WT + MO1-gmppb standard conditions Fig. 6 from Carss et al., 2013
eye decreased size, abnormal WT + MO1-gmppb standard conditions Fig. 6Fig. S11 from Carss et al., 2013
obsolete protein glycosylation decreased process quality, abnormal WT + MO1-gmppb standard conditions Fig. 6 from Carss et al., 2013
nervous system EGFP expression decreased amount, abnormal knu3Tg + MO1-gmppb standard conditions Fig. 3 with image from Liu et al., 2021
CaP motoneuron axon decreased length, abnormal ml2Tg + MO1-gmppb standard conditions Fig. 3 with imageFig. 4 with image from Liu et al., 2021
CaP motoneuron axon length, ameliorated ml2Tg + MO1-gmppb + MO4-tp53 chemical treatment by injection: GDP-mannose Fig. 7 from Zheng et al., 2021
CaP motoneuron axon decreased length, abnormal ml2Tg + MO1-gmppb + MO4-tp53 standard conditions Fig. 7 from Zheng et al., 2021
Citations