Morpholino

MO1-fgf22

ID
ZDB-MRPHLNO-130911-1
Name
MO1-fgf22
Previous Names
  • fgf22 exon 2/intron 2 spliceblocking MO1 (1)
Target
Sequence
5' - ATGCGATGTACCTACCGATCCGAAAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fgf22
No data available
Phenotype
Phenotype resulting from MO1-fgf22
Phenotype Fish Figures
brain astrocyte glula expression decreased amount, abnormal WT + MO1-fgf22 Fig. 4 from Miyake et al., 2023
cell proliferation in midbrain decreased occurrence, abnormal WT + MO1-fgf22 Fig. 3 with image from Miyake et al., 2013
diencephalon neurog1 expression decreased amount, abnormal WT + MO1-fgf22 Fig. 3 from Miyake et al., 2023
diencephalon isl1a expression decreased amount, abnormal WT + MO1-fgf22 Fig. 3 from Miyake et al., 2023
diencephalon ventral region slc17a6a expression decreased amount, abnormal WT + MO1-fgf22 Fig. 3 from Miyake et al., 2023
dorsal telencephalon anterior region neurog1 expression decreased amount, abnormal WT + MO1-fgf22 Fig. 3 from Miyake et al., 2023
dorsal telencephalon anterior region slc17a6a expression decreased amount, abnormal WT + MO1-fgf22 Fig. 3 from Miyake et al., 2023
epiphysis isl1a expression decreased amount, abnormal WT + MO1-fgf22 Fig. 3 from Miyake et al., 2023
forebrain ascl1a expression decreased amount, abnormal WT + MO1-fgf22 Fig. 3 from Miyake et al., 2023
forebrain morphology, abnormal WT + MO1-fgf22 Fig. 2 with image from Miyake et al., 2013
forebrain astrocyte development decreased process quality, abnormal WT + MO1-fgf22 Fig. 4 from Miyake et al., 2023
forebrain neurogenesis decreased occurrence, abnormal WT + MO1-fgf22 Fig. 3 from Miyake et al., 2023
forebrain oligodendrocyte plp1a expression increased amount, abnormal WT + MO1-fgf22 Fig. 4 from Miyake et al., 2023
forebrain oligodendrocyte olig2 expression increased amount, abnormal WT + MO1-fgf22 Fig. 4 from Miyake et al., 2023
forebrain oligodendrocyte development increased process quality, abnormal WT + MO1-fgf22 Fig. 4 from Miyake et al., 2023
forebrain development disrupted, abnormal WT + MO1-fgf22 Fig. 2 with image from Miyake et al., 2013
midbrain plp1a expression mislocalised, abnormal WT + MO1-fgf22 Fig. 4 from Miyake et al., 2023
midbrain morphology, abnormal WT + MO1-fgf22 Fig. 2 with image from Miyake et al., 2013
midbrain development disrupted, abnormal WT + MO1-fgf22 + MO4-tp53 Fig. 2 with imageFig. 5 with image from Miyake et al., 2013
midbrain hindbrain boundary morphology, abnormal WT + MO1-fgf22 + MO4-tp53 Fig. 2 with image from Miyake et al., 2013
midbrain-hindbrain boundary development disrupted, abnormal WT + MO1-fgf22 + MO4-tp53 Fig. 2 with image from Miyake et al., 2013
roof plate formation disrupted, abnormal WT + MO1-fgf22 Fig. 4 with image from Miyake et al., 2013
roof plate midbrain region increased width, abnormal WT + MO1-fgf22 Fig. 4 with image from Miyake et al., 2013
telencephalon isl1a expression decreased amount, abnormal WT + MO1-fgf22 Fig. 3 from Miyake et al., 2023
telencephalon gad1b expression decreased amount, abnormal WT + MO1-fgf22 Fig. 3 from Miyake et al., 2023
ventral telencephalon dlx2a expression decreased amount, abnormal WT + MO1-fgf22 Fig. 2 from Miyake et al., 2023
ventral telencephalon gad1b expression decreased amount, abnormal WT + MO1-fgf22 Fig. 3 from Miyake et al., 2023
ventral thalamus dlx2a expression decreased amount, abnormal WT + MO1-fgf22 Fig. 2 from Miyake et al., 2023
Phenotype of all Fish created by or utilizing MO1-fgf22
Phenotype Fish Conditions Figures
forebrain oligodendrocyte plp1a expression increased amount, abnormal WT + MO1-fgf22 standard conditions Fig. 4 from Miyake et al., 2023
diencephalon ventral region slc17a6a expression decreased amount, abnormal WT + MO1-fgf22 standard conditions Fig. 3 from Miyake et al., 2023
roof plate midbrain region increased width, abnormal WT + MO1-fgf22 standard conditions Fig. 4 with image from Miyake et al., 2013
midbrain plp1a expression mislocalised, abnormal WT + MO1-fgf22 standard conditions Fig. 4 from Miyake et al., 2023
ventral thalamus dlx2a expression decreased amount, abnormal WT + MO1-fgf22 standard conditions Fig. 2 from Miyake et al., 2023
ventral telencephalon gad1b expression decreased amount, abnormal WT + MO1-fgf22 standard conditions Fig. 3 from Miyake et al., 2023
dorsal telencephalon anterior region neurog1 expression decreased amount, abnormal WT + MO1-fgf22 standard conditions Fig. 3 from Miyake et al., 2023
roof plate formation disrupted, abnormal WT + MO1-fgf22 standard conditions Fig. 4 with image from Miyake et al., 2013
cell proliferation in midbrain decreased occurrence, abnormal WT + MO1-fgf22 standard conditions Fig. 3 with image from Miyake et al., 2013
midbrain hindbrain boundary morphology, abnormal WT + MO1-fgf22 standard conditions Fig. 2 with image from Miyake et al., 2013
forebrain oligodendrocyte development increased process quality, abnormal WT + MO1-fgf22 standard conditions Fig. 4 from Miyake et al., 2023
ventral telencephalon dlx2a expression decreased amount, abnormal WT + MO1-fgf22 standard conditions Fig. 2 from Miyake et al., 2023
telencephalon isl1a expression decreased amount, abnormal WT + MO1-fgf22 standard conditions Fig. 3 from Miyake et al., 2023
forebrain ascl1a expression decreased amount, abnormal WT + MO1-fgf22 standard conditions Fig. 3 from Miyake et al., 2023
forebrain development disrupted, abnormal WT + MO1-fgf22 standard conditions Fig. 2 with image from Miyake et al., 2013
telencephalon gad1b expression decreased amount, abnormal WT + MO1-fgf22 standard conditions Fig. 3 from Miyake et al., 2023
midbrain-hindbrain boundary development disrupted, abnormal WT + MO1-fgf22 standard conditions Fig. 2 with image from Miyake et al., 2013
diencephalon isl1a expression decreased amount, abnormal WT + MO1-fgf22 standard conditions Fig. 3 from Miyake et al., 2023
epiphysis isl1a expression decreased amount, abnormal WT + MO1-fgf22 standard conditions Fig. 3 from Miyake et al., 2023
forebrain oligodendrocyte olig2 expression increased amount, abnormal WT + MO1-fgf22 standard conditions Fig. 4 from Miyake et al., 2023
midbrain development disrupted, abnormal WT + MO1-fgf22 standard conditions Fig. 2 with imageFig. 5 with image from Miyake et al., 2013
diencephalon neurog1 expression decreased amount, abnormal WT + MO1-fgf22 standard conditions Fig. 3 from Miyake et al., 2023
midbrain morphology, abnormal WT + MO1-fgf22 standard conditions Fig. 2 with image from Miyake et al., 2013
brain astrocyte glula expression decreased amount, abnormal WT + MO1-fgf22 standard conditions Fig. 4 from Miyake et al., 2023
forebrain morphology, abnormal WT + MO1-fgf22 standard conditions Fig. 2 with image from Miyake et al., 2013
forebrain neurogenesis decreased occurrence, abnormal WT + MO1-fgf22 standard conditions Fig. 3 from Miyake et al., 2023
dorsal telencephalon anterior region slc17a6a expression decreased amount, abnormal WT + MO1-fgf22 standard conditions Fig. 3 from Miyake et al., 2023
forebrain astrocyte development decreased process quality, abnormal WT + MO1-fgf22 standard conditions Fig. 4 from Miyake et al., 2023
forebrain development disrupted, abnormal WT + MO1-fgf22 + MO4-tp53 standard conditions Fig. 2 with image from Miyake et al., 2013
midbrain-hindbrain boundary development disrupted, abnormal WT + MO1-fgf22 + MO4-tp53 standard conditions Fig. 2 with image from Miyake et al., 2013
midbrain development disrupted, abnormal WT + MO1-fgf22 + MO4-tp53 standard conditions Fig. 2 with image from Miyake et al., 2013
midbrain hindbrain boundary morphology, abnormal WT + MO1-fgf22 + MO4-tp53 standard conditions Fig. 2 with image from Miyake et al., 2013
forebrain morphology, abnormal WT + MO1-fgf22 + MO4-tp53 standard conditions Fig. 2 with image from Miyake et al., 2013
midbrain morphology, abnormal WT + MO1-fgf22 + MO4-tp53 standard conditions Fig. 2 with image from Miyake et al., 2013
Citations