Morpholino

MO1-ldlra

ID
ZDB-MRPHLNO-150312-1
Name
MO1-ldlra
Previous Names
None
Target
Sequence
5' - AGATCACATTTCATTTCTTACAGCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ldlra
No data available
Phenotype
Phenotype resulting from MO1-ldlra
Phenotype of all Fish created by or utilizing MO1-ldlra
Phenotype Fish Conditions Figures
caudal vein cholesterol increased amount, abnormal TU + MO1-ldlra control Fig. 3 from Montasser et al., 2018
whole organism low-density lipoprotein cholesterol increased amount, abnormal TU + MO1-ldlra control Fig. 3 from Montasser et al., 2018
caudal vein cholesterol increased amount, abnormal TU + MO1-ldlra high cholesterol Fig. 3 from Montasser et al., 2018
whole organism low-density lipoprotein cholesterol increased amount, abnormal TU + MO1-ldlra high cholesterol Fig. 3 from Montasser et al., 2018
liver increased size, abnormal WT + MO1-ldlra standard conditions Fig. S7 from O'Hare et al., 2014
posterior cardinal vein vascular endothelium increased permeability, abnormal WT + MO1-ldlra high cholesterol Fig. 5 from O'Hare et al., 2014
liver fatty, abnormal WT + MO1-ldlra high cholesterol Fig. S7 from O'Hare et al., 2014
posterior cardinal vein fatty, abnormal WT + MO1-ldlra high cholesterol Fig. 3 from O'Hare et al., 2014
posterior cardinal vein fatty, abnormal WT + MO1-ldlra standard conditions Fig. 3 from O'Hare et al., 2014
cholesterol homeostasis process quality, abnormal WT + MO1-ldlra standard conditions Fig. 2Fig. 3Fig. S6 from O'Hare et al., 2014
vasculature macrophage mislocalised, abnormal WT + MO1-ldlra high cholesterol Fig. 4 from O'Hare et al., 2014
liver fatty, abnormal WT + MO1-ldlra standard conditions Fig. S7 from O'Hare et al., 2014
posterior cardinal vein fatty, abnormal WT + MO1-ldlra high cholesterol, chemical treatment: atorvastatin Fig. 3 from O'Hare et al., 2014
posterior cardinal vein has extra parts of type macrophage, abnormal WT + MO1-ldlra high cholesterol Fig. 4 from O'Hare et al., 2014
posterior cardinal vein vascular endothelium increased permeability, abnormal WT + MO1-ldlra standard conditions Fig. 5 from O'Hare et al., 2014
cholesterol homeostasis process quality, abnormal WT + MO1-ldlra high cholesterol, chemical treatment: atorvastatin Fig. 3 from O'Hare et al., 2014
liver increased size, abnormal WT + MO1-ldlra high cholesterol Fig. S7 from O'Hare et al., 2014
cholesterol homeostasis process quality, abnormal WT + MO1-ldlra high cholesterol Fig. 2Fig. 3 from O'Hare et al., 2014
posterior cardinal vein lipid oxidation increased occurrence, abnormal sd16Tg + MO1-ldlra heat shock Fig. 4 from O'Hare et al., 2014
posterior cardinal vein lipid oxidation increased occurrence, abnormal sd16Tg + MO1-ldlra high cholesterol, heat shock Fig. 4 from O'Hare et al., 2014
Citations