Morpholino

MO2-ak2

ID
ZDB-MRPHLNO-151117-1
Name
MO2-ak2
Previous Names
None
Target
Sequence
5' - CATGGCTACAGCTTCTTTACTAACT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ak2
No data available
Phenotype
Phenotype resulting from MO2-ak2
Phenotype of all Fish created by or utilizing MO2-ak2
Phenotype Fish Conditions Figures
hematopoietic stem cell differentiation decreased process quality, abnormal EKW + MO1-ak2 + MO2-ak2 control Fig. 4 from Rissone et al., 2015
granulocyte decreased amount, abnormal EKW + MO1-ak2 + MO2-ak2 control Fig. 3 from Rissone et al., 2015
intermediate cell mass of mesoderm apoptotic process increased process quality, abnormal EKW + MO1-ak2 + MO2-ak2 control Fig. 5 from Rissone et al., 2015
blood island apoptotic process increased process quality, abnormal EKW + MO1-ak2 + MO2-ak2 control Fig. 5 from Rissone et al., 2015
hematopoietic progenitor cell differentiation decreased process quality, abnormal EKW + MO1-ak2 + MO2-ak2 control Fig. 4 from Rissone et al., 2015
hematopoietic system apoptotic process increased process quality, abnormal EKW + MO1-ak2 + MO2-ak2 control Fig. 5 from Rissone et al., 2015
hematopoietic stem cell differentiation decreased process quality, abnormal EKW + MO2-ak2 control Fig. 4 from Rissone et al., 2015
intermediate cell mass of mesoderm apoptotic process increased process quality, abnormal EKW + MO2-ak2 control Fig. 5 from Rissone et al., 2015
granulocyte decreased amount, abnormal EKW + MO2-ak2 control Fig. 3 from Rissone et al., 2015
myeloid cell development decreased process quality, abnormal EKW + MO2-ak2 control Fig. 3 from Rissone et al., 2015
blood island apoptotic process increased process quality, abnormal EKW + MO2-ak2 control Fig. 5 from Rissone et al., 2015
myeloid leukocyte differentiation decreased process quality, abnormal EKW + MO2-ak2 control Fig. 3 from Rissone et al., 2015
hematopoietic progenitor cell differentiation decreased process quality, abnormal EKW + MO2-ak2 control Fig. 4 from Rissone et al., 2015
hematopoietic system apoptotic process increased process quality, abnormal EKW + MO2-ak2 control Fig. 5 from Rissone et al., 2015
lymphocyte differentiation decreased process quality, abnormal EKW + MO2-ak2 control Fig. 3 from Rissone et al., 2015
hematopoietic stem cell differentiation decreased process quality, abnormal la2Tg + MO1-ak2 + MO2-ak2 control Fig. 4 from Rissone et al., 2015
hematopoietic progenitor cell differentiation decreased process quality, abnormal la2Tg + MO1-ak2 + MO2-ak2 control Fig. 4 from Rissone et al., 2015
hematopoietic stem cell differentiation decreased process quality, abnormal la2Tg + MO2-ak2 control Fig. 4 from Rissone et al., 2015
hematopoietic progenitor cell differentiation decreased process quality, abnormal la2Tg + MO2-ak2 control Fig. 4 from Rissone et al., 2015
Citations