Morpholino

MO1-atp6ap1b

ID
ZDB-MRPHLNO-160202-1
Name
MO1-atp6ap1b
Previous Names
None
Target
Sequence
5' - AACGCCGCATTCCTACTTCCGTCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-atp6ap1b
No data available
Phenotype
Phenotype resulting from MO1-atp6ap1b
Phenotype Fish Figures
ciliated cell cell decreased amount, abnormal WT + MO1-atp6ap1b Fig. 2 with image from Gokey et al., 2015
determination of left/right asymmetry in lateral mesoderm decreased occurrence, abnormal WT + MO1-atp6ap1b Fig. 3 with image from Gokey et al., 2015
EVL plasma membrane ab4-atp6v1a labeling decreased amount, abnormal WT + MO1-atp6ap1b Fig. S4 from Gokey et al., 2015
forerunner cell group Ab1-atp6ap1 labeling decreased amount, abnormal s870Tg + MO1-atp6ap1b Fig. 1 with image from Gokey et al., 2015
forerunner cell group cell decreased amount, abnormal s870Tg + MO1-atp6ap1b Fig. 8 with image from Gokey et al., 2015
forerunner cell group cell population proliferation decreased occurrence, abnormal s870Tg + MO1-atp6ap1b Fig. 8 with image from Gokey et al., 2015
forerunner cell group cytoplasm decreased acidity, abnormal s870Tg + MO1-atp6ap1b Fig. 6 with image from Gokey et al., 2015
forerunner cell group plasma membrane ab4-atp6v1a labeling decreased amount, abnormal s870Tg + MO1-atp6ap1b Fig. 7 with image from Gokey et al., 2015
forerunner cell group plasma membrane Ab1-atp6ap1 labeling decreased amount, abnormal s870Tg + MO1-atp6ap1b Fig. 1 with image from Gokey et al., 2015
heart looping decreased occurrence, abnormal WT + MO1-atp6ap1b Fig. 3 with image from Gokey et al., 2015
heart looping process quality, abnormal WT + MO1-atp6ap1b Fig. 3 with image from Gokey et al., 2015
Kupffer's vesicle decreased size, abnormal s870Tg + MO1-atp6ap1b Fig. 2 with imageFig. 8 with image from Gokey et al., 2015
Kupffer's vesicle cell decreased amount, abnormal s870Tg + MO1-atp6ap1b Fig. 8 with image from Gokey et al., 2015
Kupffer's vesicle cilium decreased amount, abnormal WT + MO1-atp6ap1b Fig. 2 with image from Gokey et al., 2015
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-atp6ap1b Fig. 2 with image from Gokey et al., 2015
mesoderm spaw expression mislocalised, abnormal WT + MO1-atp6ap1b Fig. 3 with image from Gokey et al., 2015
mesoderm right side spaw expression mislocalised, abnormal WT + MO1-atp6ap1b Fig. 3 with image from Gokey et al., 2015
neuromast decreased size, abnormal WT + MO1-atp6ap1b Fig. 2 with image from Gokey et al., 2015
neuromast kinocilium decreased length, abnormal WT + MO1-atp6ap1b Fig. 2 with image from Gokey et al., 2015
neuromast hair cell basal region ab4-atp6v1a labeling decreased amount, abnormal WT + MO1-atp6ap1b Fig. S4 from Gokey et al., 2015
whole organism Ab1-atp6ap1 labeling decreased amount, abnormal WT + MO1-atp6ap1b Fig. 1 with image from Gokey et al., 2015
Phenotype of all Fish created by or utilizing MO1-atp6ap1b
Phenotype Fish Conditions Figures
mesoderm spaw expression mislocalised, abnormal WT + MO1-atp6ap1b standard conditions Fig. 3 with image from Gokey et al., 2015
neuromast decreased size, abnormal WT + MO1-atp6ap1b standard conditions Fig. 2 with image from Gokey et al., 2015
neuromast kinocilium decreased length, abnormal WT + MO1-atp6ap1b standard conditions Fig. 2 with image from Gokey et al., 2015
Kupffer's vesicle cilium decreased amount, abnormal WT + MO1-atp6ap1b standard conditions Fig. 2 with image from Gokey et al., 2015
heart looping decreased occurrence, abnormal WT + MO1-atp6ap1b standard conditions Fig. 3 with image from Gokey et al., 2015
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-atp6ap1b standard conditions Fig. 2 with image from Gokey et al., 2015
ciliated cell cell decreased amount, abnormal WT + MO1-atp6ap1b standard conditions Fig. 2 with image from Gokey et al., 2015
heart looping process quality, abnormal WT + MO1-atp6ap1b standard conditions Fig. 3 with image from Gokey et al., 2015
Kupffer's vesicle decreased size, abnormal WT + MO1-atp6ap1b standard conditions Fig. 2 with image from Gokey et al., 2015
determination of left/right asymmetry in lateral mesoderm decreased occurrence, abnormal WT + MO1-atp6ap1b standard conditions Fig. 3 with image from Gokey et al., 2015
mesoderm right side spaw expression mislocalised, abnormal WT + MO1-atp6ap1b standard conditions Fig. 3 with image from Gokey et al., 2015
neuromast hair cell basal region ab4-atp6v1a labeling decreased amount, abnormal WT + MO1-atp6ap1b standard conditions Fig. S4 from Gokey et al., 2015
whole organism Ab1-atp6ap1 labeling decreased amount, abnormal WT + MO1-atp6ap1b standard conditions Fig. 1 with image from Gokey et al., 2015
EVL plasma membrane ab4-atp6v1a labeling decreased amount, abnormal WT + MO1-atp6ap1b standard conditions Fig. S4 from Gokey et al., 2015
forerunner cell group cytoplasm decreased acidity, abnormal s870Tg + MO1-atp6ap1b standard conditions Fig. 6 with image from Gokey et al., 2015
forerunner cell group cell decreased amount, abnormal s870Tg + MO1-atp6ap1b standard conditions Fig. 8 with image from Gokey et al., 2015
forerunner cell group cell population proliferation decreased occurrence, abnormal s870Tg + MO1-atp6ap1b standard conditions Fig. 8 with image from Gokey et al., 2015
Kupffer's vesicle cell decreased amount, abnormal s870Tg + MO1-atp6ap1b standard conditions Fig. 8 with image from Gokey et al., 2015
forerunner cell group plasma membrane ab4-atp6v1a labeling decreased amount, abnormal s870Tg + MO1-atp6ap1b standard conditions Fig. 7 with image from Gokey et al., 2015
Kupffer's vesicle decreased size, abnormal s870Tg + MO1-atp6ap1b standard conditions Fig. 2 with imageFig. 8 with image from Gokey et al., 2015
forerunner cell group Ab1-atp6ap1 labeling decreased amount, abnormal s870Tg + MO1-atp6ap1b standard conditions Fig. 1 with image from Gokey et al., 2015
forerunner cell group plasma membrane Ab1-atp6ap1 labeling decreased amount, abnormal s870Tg + MO1-atp6ap1b standard conditions Fig. 1 with image from Gokey et al., 2015
heart looping decreased occurrence, abnormal WT + MO1-atp6ap1b + MO1-atp6v1f standard conditions Fig. S4 from Gokey et al., 2015
Citations