Morpholino

MO2-tnksb

ID

ZDB-MRPHLNO-160216-2

Name

MO2-tnksb

Previous Names

Target

Sequence

5' - GGTGAAAGTGACTTACAGGTGAGTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

splice-blocker

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-tnksb

No data available

Phenotype

Phenotype resulting from MO2-tnksb

Phenotype	Fish	Figures
glucose homeostasis process quality, abnormal	WT + MO2-tnksb	Fig. 3 from Wang et al., 2015
pars intermedia melanocyte stimulating hormone secreting cell ab2-amsh labeling decreased amount, abnormal	WT + MO2-tnksb	Fig. 5 from Wang et al., 2015
pars intermedia melanocyte stimulating hormone secreting cell pomca expression decreased amount, abnormal	WT + MO2-tnksb	Fig. 5 from Wang et al., 2015
whole organism pomca expression decreased amount, abnormal	WT + MO2-tnksb	Fig. 5 from Wang et al., 2015
whole organism pck1 expression decreased amount, abnormal	WT + MO2-tnksb	Fig. 3 from Wang et al., 2015
whole organism decreased length, abnormal	WT + MO2-tnksb	Fig. 2 from Wang et al., 2015
whole organism mc4r expression increased amount, abnormal	WT + MO2-tnksb	Fig. 7 from Wang et al., 2015
whole organism ins expression increased amount, abnormal	WT + MO2-tnksb	Fig. 3 from Wang et al., 2015
whole organism ab1-slc2a4 labeling increased amount, abnormal	WT + MO2-tnksb	Fig. 3 from Wang et al., 2015

Phenotype of all Fish created by or utilizing MO2-tnksb

Phenotype	Fish	Conditions	Figures
whole organism mc4r expression increased amount, abnormal	WT + MO2-tnksb	standard conditions	Fig. 7 from Wang et al., 2015
whole organism pck1 expression decreased amount, abnormal	WT + MO2-tnksb	standard conditions	Fig. 3 from Wang et al., 2015
whole organism pomca expression decreased amount, abnormal	WT + MO2-tnksb	standard conditions	Fig. 5 from Wang et al., 2015
whole organism ab1-slc2a4 labeling increased amount, abnormal	WT + MO2-tnksb	standard conditions	Fig. 3 from Wang et al., 2015
glucose homeostasis process quality, abnormal	WT + MO2-tnksb	standard conditions	Fig. 3 from Wang et al., 2015
pars intermedia melanocyte stimulating hormone secreting cell ab2-amsh labeling decreased amount, abnormal	WT + MO2-tnksb	control	Fig. 5 from Wang et al., 2015
pars intermedia melanocyte stimulating hormone secreting cell pomca expression decreased amount, abnormal	WT + MO2-tnksb	standard conditions	Fig. 5 from Wang et al., 2015
whole organism ins expression increased amount, abnormal	WT + MO2-tnksb	standard conditions	Fig. 3 from Wang et al., 2015
whole organism decreased length, abnormal	WT + MO2-tnksb	standard conditions	Fig. 2 from Wang et al., 2015

Citations