Morpholino

MO1-tpcn2

ID
ZDB-MRPHLNO-160427-2
Name
MO1-tpcn2
Previous Names
  • TPCN2-MO-T (1)
Target
Sequence
5' - CAGCCAGCAGCGGTTCTTCTTCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tpcn2
No data available
Phenotype
Phenotype resulting from MO1-tpcn2
Phenotype Fish Figures
calcium-mediated signaling decreased process quality, abnormal hkz100Tg + MO1-tpcn2 + MO4-tp53 Fig. 1 from Kelu et al., 2015
CaP motoneuron release of sequestered calcium ion into cytosol asynchronous, abnormal nksaigff213aGt; zf415Tg + MO1-tpcn2 + MO4-tp53 Fig. 1 with image from Kelu et al., 2018
CaP motoneuron release of sequestered calcium ion into cytosol occurrence, abnormal nksaigff213aGt; zf415Tg + MO1-tpcn2 + MO4-tp53 Fig. 1 with image from Kelu et al., 2018
myotome decreased width, abnormal WT + MO1-tpcn2 + MO4-tp53 Fig. 3 with image,  Fig. 4 with image,  Fig. 6 with image from Kelu et al., 2017
slow muscle cell decreased amount, abnormal WT + MO1-tpcn2 + MO4-tp53 Fig. 4 with image,  Fig. 6 with image from Kelu et al., 2017
slow muscle cell ab-f59 labeling decreased amount, abnormal AB + MO1-tpcn2 + MO4-tp53 Fig. 3 from Kelu et al., 2015
slow muscle cell tpcn2 expression decreased amount, abnormal AB + MO1-tpcn2 + MO4-tp53 Fig. 3 from Kelu et al., 2015
slow muscle cell calcium-mediated signaling process quality, abnormal hkz100Tg + MO1-tpcn2 + MO4-tp53 (AB) Fig. 7 from Kelu et al., 2017
slow muscle cell sarcomere morphology, abnormal WT + MO1-tpcn2 + MO4-tp53 Fig. 3 with image,  Fig. 6 with image from Kelu et al., 2017
slow muscle cell skeletal muscle myofibril disorganized, abnormal WT + MO1-tpcn2 + MO4-tp53 Fig. 3 with image,  Fig. 6 with image from Kelu et al., 2017
somite U-shaped, abnormal WT + MO1-tpcn2 + MO4-tp53 Fig. 3 with image,  Fig. 4 with image,  Fig. 6 with image from Kelu et al., 2017
striated muscle cell decreased width, abnormal WT + MO1-tpcn2 + MO4-tp53 Fig. 4 with image,  Fig. 6 with image from Kelu et al., 2017
striated muscle cell increased length, abnormal WT + MO1-tpcn2 + MO4-tp53 Fig. 4 with image,  Fig. 6 with image from Kelu et al., 2017
Phenotype of all Fish created by or utilizing MO1-tpcn2
Phenotype Fish Conditions Figures
slow muscle cell ab-f59 labeling decreased amount, abnormal AB + MO1-tpcn2 + MO4-tp53 standard conditions Fig. 3 from Kelu et al., 2015
slow muscle cell tpcn2 expression decreased amount, abnormal AB + MO1-tpcn2 + MO4-tp53 standard conditions Fig. 3 from Kelu et al., 2015
slow muscle cell decreased amount, abnormal WT + MO1-tpcn2 + MO2-tpcn2 + MO4-tp53 standard conditions Fig. 4 with image from Kelu et al., 2017
striated muscle cell decreased width, abnormal WT + MO1-tpcn2 + MO2-tpcn2 + MO4-tp53 standard conditions Fig. 4 with image from Kelu et al., 2017
somite U-shaped, abnormal WT + MO1-tpcn2 + MO2-tpcn2 + MO4-tp53 standard conditions Fig. 3 with image,  Fig. 4 with image from Kelu et al., 2017
slow muscle cell sarcomere morphology, abnormal WT + MO1-tpcn2 + MO2-tpcn2 + MO4-tp53 standard conditions Fig. 3 with image from Kelu et al., 2017
myotome decreased width, abnormal WT + MO1-tpcn2 + MO2-tpcn2 + MO4-tp53 standard conditions Fig. 3 with image,  Fig. 4 with image from Kelu et al., 2017
striated muscle cell increased length, abnormal WT + MO1-tpcn2 + MO2-tpcn2 + MO4-tp53 standard conditions Fig. 4 with image from Kelu et al., 2017
slow muscle cell skeletal muscle myofibril disorganized, abnormal WT + MO1-tpcn2 + MO2-tpcn2 + MO4-tp53 standard conditions Fig. 3 with image from Kelu et al., 2017
striated muscle cell width, ameliorated WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: D-myo-Ins(1,4,5)P3 hexakis(butyryloxymethyl) ester Fig. 6 with image from Kelu et al., 2017
slow muscle cell decreased amount, abnormal WT + MO1-tpcn2 + MO4-tp53 standard conditions Fig. 4 with image,  Fig. 6 with image from Kelu et al., 2017
myotome width, ameliorated WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: D-myo-Ins(1,4,5)P3 hexakis(butyryloxymethyl) ester Fig. 6 with image from Kelu et al., 2017
striated muscle cell decreased width, abnormal WT + MO1-tpcn2 + MO4-tp53 standard conditions Fig. 4 with image,  Fig. 6 with image from Kelu et al., 2017
striated muscle cell increased length, abnormal WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: caffeine Fig. 6 with image from Kelu et al., 2017
somite U-shaped, abnormal WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: D-myo-Ins(1,4,5)P3 hexakis(butyryloxymethyl) ester Fig. 6 with image from Kelu et al., 2017
slow muscle cell skeletal muscle myofibril organization quality, ameliorated WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: D-myo-Ins(1,4,5)P3 hexakis(butyryloxymethyl) ester Fig. 6 with image from Kelu et al., 2017
somite U-shaped, abnormal WT + MO1-tpcn2 + MO4-tp53 standard conditions Fig. 3 with image,  Fig. 4 with image,  Fig. 6 with image from Kelu et al., 2017
myotome width, ameliorated WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: caffeine Fig. 6 with image from Kelu et al., 2017
striated muscle cell width, ameliorated WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: caffeine Fig. 6 with image from Kelu et al., 2017
somite U-shaped, abnormal WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: caffeine Fig. 6 with image from Kelu et al., 2017
slow muscle cell sarcomere morphology, abnormal WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: caffeine Fig. 6 with image from Kelu et al., 2017
slow muscle cell sarcomere morphology, abnormal WT + MO1-tpcn2 + MO4-tp53 standard conditions Fig. 3 with image,  Fig. 6 with image from Kelu et al., 2017
striated muscle cell increased length, abnormal WT + MO1-tpcn2 + MO4-tp53 standard conditions Fig. 4 with image,  Fig. 6 with image from Kelu et al., 2017
myotome decreased width, abnormal WT + MO1-tpcn2 + MO4-tp53 standard conditions Fig. 3 with image,  Fig. 4 with image,  Fig. 6 with image from Kelu et al., 2017
slow muscle cell amount, ameliorated WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: D-myo-Ins(1,4,5)P3 hexakis(butyryloxymethyl) ester Fig. 6 with image from Kelu et al., 2017
striated muscle cell length, ameliorated WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: D-myo-Ins(1,4,5)P3 hexakis(butyryloxymethyl) ester Fig. 6 with image from Kelu et al., 2017
slow muscle cell skeletal muscle myofibril disorganized, abnormal WT + MO1-tpcn2 + MO4-tp53 standard conditions Fig. 3 with image,  Fig. 6 with image from Kelu et al., 2017
slow muscle cell sarcomere morphology, ameliorated WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: D-myo-Ins(1,4,5)P3 hexakis(butyryloxymethyl) ester Fig. 6 with image from Kelu et al., 2017
slow muscle cell amount, ameliorated WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: caffeine Fig. 6 with image from Kelu et al., 2017
slow muscle cell skeletal muscle myofibril disorganized, abnormal WT + MO1-tpcn2 + MO4-tp53 chemical treatment by environment: caffeine Fig. 6 with image from Kelu et al., 2017
calcium-mediated signaling decreased process quality, abnormal hkz100Tg + MO1-tpcn2 + MO4-tp53 standard conditions Fig. 1 from Kelu et al., 2015
slow muscle cell calcium-mediated signaling process quality, ameliorated hkz100Tg + MO1-tpcn2 + MO4-tp53 (AB) chemical treatment by environment: D-myo-Ins(1,4,5)P3 hexakis(butyryloxymethyl) ester Fig. 7 from Kelu et al., 2017
slow muscle cell calcium-mediated signaling process quality, abnormal hkz100Tg + MO1-tpcn2 + MO4-tp53 (AB) control Fig. 7 from Kelu et al., 2017
slow muscle cell calcium-mediated signaling process quality, ameliorated hkz100Tg + MO1-tpcn2 + MO4-tp53 (AB) chemical treatment by environment: caffeine Fig. 7 from Kelu et al., 2017
CaP motoneuron release of sequestered calcium ion into cytosol asynchronous, abnormal nksaigff213aGt; zf415Tg + MO1-tpcn2 + MO4-tp53 standard conditions Fig. 1 with image from Kelu et al., 2018
CaP motoneuron release of sequestered calcium ion into cytosol occurrence, abnormal nksaigff213aGt; zf415Tg + MO1-tpcn2 + MO4-tp53 standard conditions Fig. 1 with image from Kelu et al., 2018
Citations