Morpholino
MO1-cdh13
- ID
- ZDB-MRPHLNO-170306-5
- Name
- MO1-cdh13
- Previous Names
- None
- Target
- Sequence
- 
    
        
        
    
        
            
                5' - GCACTGTAAACATCTTACCCTGAGT - 3'
                
            
            
                
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- 
    
        
        
    
        
            Splice-blocking MO.
- Genome Resources
- None
                
                    
                        Target Location
                    
                    
                
                
            
        
        
    
        
            
            
    
        
    
    
    
        
        
    
    
    
                
                    
                        Genomic Features
                    
                    
                
                
            
        
        
    
        
            
            
    
    
        
    
No data available
    
        
        
    
    
    
                
                    
                        Expression
                    
                    
                
                
            
        
        
    
        
            
            
    
    
                
                    
                        Gene expression in Wild Types + MO1-cdh13
                    
                    
                
                
            
        
        
    
        
            
                
    
    
        
    
No data available
    
            
        
    
    
    
                
                    
                        Phenotype
                    
                    
                
                
            
        
        
    
        
            
            
    
    
                
                    
                        Phenotype resulting from MO1-cdh13
                    
                    
                
                
            
        
        
    
        
            
                
    
    
        
    
No data available
    
            
        
    
    
    
                
                    
                        Phenotype of all Fish created by or utilizing MO1-cdh13
                    
                    
                
                
            
        
        
    
        
            
                
    
        
    | Phenotype | Fish | Conditions | Figures | 
|---|---|---|---|
| blood circulation decreased occurrence, abnormal | ubs1Tg + MO1-cdh13 + MO1-tnnt2a | control | Fig. 5  from Serbanovic-Canic et al., 2017 | 
| endothelial cell apoptotic process increased occurrence, exacerbated | ubs1Tg + MO1-cdh13 + MO1-tnnt2a | control | Fig. 5  from Serbanovic-Canic et al., 2017 | 
                
                    
                        Citations
                    
                    
                
                
            
        
        
    
        
            
            
        
        
    
    
    