Morpholino

MO2-tinagl1

ID
ZDB-MRPHLNO-170822-1
Name
MO2-tinagl1
Previous Names
  • TEx1 MO (1)
Target
Sequence
5' - GACATATTAAACTCACTGGGAGGGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tinagl1
No data available
Phenotype
Phenotype resulting from MO2-tinagl1
Phenotype of all Fish created by or utilizing MO2-tinagl1
Phenotype Fish Conditions Figures
Meckel's cartilage shape, abnormal TU + MO2-tinagl1 standard conditions Fig. 1 from Neiswender et al., 2017
Meckel's cartilage decreased size, abnormal TU + MO2-tinagl1 standard conditions Fig. 1 from Neiswender et al., 2017
ceratobranchial cartilage disorganized, abnormal TU + MO2-tinagl1 control Fig. 4 from Neiswender et al., 2017
pharyngeal arch neural crest cell dlx2a expression decreased distribution, abnormal TU + MO2-tinagl1 standard conditions Fig. 3 from Neiswender et al., 2017
ceratohyal cartilage mislocalised, abnormal TU + MO2-tinagl1 standard conditions Fig. 1 from Neiswender et al., 2017
ethmoid cartilage morphology, abnormal TU + MO2-tinagl1 standard conditions Fig. 1 from Neiswender et al., 2017
pharyngeal arch 3-7 skeleton lacks parts or has fewer parts of type ceratobranchial cartilage, abnormal TU + MO2-tinagl1 standard conditions Fig. 1 from Neiswender et al., 2017
embryonic viscerocranium morphogenesis disrupted, abnormal TU + MO2-tinagl1 control Fig. 1Fig. 4 from Neiswender et al., 2017
ceratohyal cartilage posterior orientation, abnormal TU + MO2-tinagl1 standard conditions Fig. 1 from Neiswender et al., 2017
Meckel's cartilage shape, abnormal TU + MO2-tinagl1 + MO3-tinagl1 standard conditions Fig. 1 from Neiswender et al., 2017
ceratohyal cartilage mislocalised, abnormal TU + MO2-tinagl1 + MO3-tinagl1 standard conditions Fig. 1 from Neiswender et al., 2017
pharyngeal arch 3-7 skeleton lacks parts or has fewer parts of type ceratobranchial cartilage, abnormal TU + MO2-tinagl1 + MO3-tinagl1 standard conditions Fig. 1 from Neiswender et al., 2017
embryonic viscerocranium morphogenesis disrupted, abnormal TU + MO2-tinagl1 + MO3-tinagl1 standard conditions Fig. 1 from Neiswender et al., 2017
Meckel's cartilage decreased size, abnormal TU + MO2-tinagl1 + MO3-tinagl1 standard conditions Fig. 1 from Neiswender et al., 2017
ceratohyal cartilage posterior orientation, abnormal TU + MO2-tinagl1 + MO3-tinagl1 standard conditions Fig. 1 from Neiswender et al., 2017
ethmoid cartilage aplastic, abnormal TU + MO1-wnt3a + MO2-tinagl1 standard conditions Fig. 4Table 1 from Neiswender et al., 2017
ceratobranchial cartilage agenesis, abnormal TU + MO1-wnt3a + MO2-tinagl1 standard conditions Table 1 from Neiswender et al., 2017
embryonic viscerocranium morphogenesis disrupted, abnormal TU + MO1-wnt3a + MO2-tinagl1 standard conditions Fig. 4 from Neiswender et al., 2017
neurocranial trabecula aplastic, abnormal TU + MO1-wnt3a + MO2-tinagl1 standard conditions Fig. 4Table 1 from Neiswender et al., 2017
pharyngeal arch cartilage aplastic, abnormal TU + MO1-wnt3a + MO2-tinagl1 standard conditions Fig. 4 from Neiswender et al., 2017
Citations