Morpholino

MO2-tph2

ID
ZDB-MRPHLNO-170908-4
Name
MO2-tph2
Previous Names
None
Target
Sequence
5' - CAATGGGTTCAGCACTCACCATGGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tph2
No data available
Phenotype
Phenotype resulting from MO2-tph2
Phenotype of all Fish created by or utilizing MO2-tph2
Phenotype Fish Conditions Figures
anatomical structure cortisol amount, ameliorated WT + MO2-tph2 chemical treatment by environment: cobalt dichloride Fig. 7 from Kwan et al., 2016
hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal WT + MO2-tph2 standard conditions Fig. 2 from Kwan et al., 2016
hematopoietic multipotent progenitor cell myb expression decreased distribution, abnormal WT + MO2-tph2 standard conditions Fig. 2 from Kwan et al., 2016
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal WT + MO2-tph2 standard conditions Fig. 2Fig. 7 from Kwan et al., 2016
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal WT + MO2-tph2 chemical treatment by environment: cobalt dichloride Fig. 7 from Kwan et al., 2016
hematopoietic multipotent progenitor cell decreased amount, abnormal la2Tg + MO2-tph2 standard conditions Fig. 2 from Kwan et al., 2016
hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal WT + MO1-tph1a + MO1-tph1b + MO2-tph2 standard conditions Fig. 2 from Kwan et al., 2016
hematopoietic multipotent progenitor cell myb expression decreased distribution, abnormal WT + MO1-tph1a + MO1-tph1b + MO2-tph2 standard conditions Fig. 2 from Kwan et al., 2016
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal WT + MO1-tph1a + MO1-tph1b + MO2-tph2 standard conditions Fig. 2 from Kwan et al., 2016
hematopoietic multipotent progenitor cell decreased amount, abnormal la2Tg + MO1-tph1a + MO1-tph1b + MO2-tph2 standard conditions Fig. 2 from Kwan et al., 2016
hematopoietic multipotent progenitor cell amount, ameliorated pd27Tg; zf169Tg + MO2-tph2 chemical treatment by environment: serotonin Fig. 2 from Kwan et al., 2016
hematopoietic multipotent progenitor cell decreased amount, abnormal pd27Tg; zf169Tg + MO2-tph2 control Fig. 2Fig. 7 from Kwan et al., 2016
hematopoietic multipotent progenitor cell decreased amount, abnormal pd27Tg; zf169Tg + MO2-tph2 chemical treatment by environment: cobalt dichloride Fig. 7 from Kwan et al., 2016
hematopoietic multipotent progenitor cell decreased amount, abnormal pd27Tg; zf169Tg + MO1-tph1a + MO1-tph1b + MO2-tph2 standard conditions Fig. 2 from Kwan et al., 2016
Citations