Morpholino

MO2-linc-tr

ID
ZDB-MRPHLNO-180305-3
Name
MO2-linc-tr
Previous Names
  • TRMO2 (1)
Target
Sequence
5' - TCAAGTTAATCTGCTCAGTGTTGTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-linc-tr
No data available
Phenotype
Phenotype resulting from MO2-linc-tr
Phenotype Fish Figures
blood cell morphology, abnormal WT + MO2-linc-tr Fig. 5S from Alcaraz-Pérez et al., 2014
caudal hematopoietic tissue spi1b expression decreased amount, abnormal AB + MO2-linc-tr Fig. S1 from García-Castillo et al., 2021
caudal hematopoietic tissue terc expression decreased amount, abnormal AB + MO2-linc-tr Fig. S1 from García-Castillo et al., 2021
caudal hematopoietic tissue csf3a expression decreased amount, abnormal AB + MO2-linc-tr Fig. S1 from García-Castillo et al., 2021
caudal hematopoietic tissue csf3b expression decreased amount, abnormal AB + MO2-linc-tr Fig. S1 from García-Castillo et al., 2021
caudal hematopoietic tissue spi1a expression decreased amount, abnormal AB + MO2-linc-tr Fig. S1 from García-Castillo et al., 2021
cell chromosome, telomeric region decreased length, abnormal WT + MO2-linc-tr Fig. 3 from Alcaraz-Pérez et al., 2014
intermediate cell mass of mesoderm spi1b expression decreased amount, abnormal WT + MO2-linc-tr Fig. 4 from Alcaraz-Pérez et al., 2014
intermediate cell mass of mesoderm csf3r expression decreased amount, abnormal WT + MO2-linc-tr Fig. 4 from Alcaraz-Pérez et al., 2014
macrophage decreased amount, abnormal gl23Tg + MO2-linc-tr Fig. 2 from Alcaraz-Pérez et al., 2014
myeloid cell csf3r expression decreased amount, abnormal WT + MO2-linc-tr Fig. 4 from Alcaraz-Pérez et al., 2014
myeloid cell spi1b expression decreased amount, abnormal WT + MO2-linc-tr Fig. 4 from Alcaraz-Pérez et al., 2014
neutrophil decreased amount, abnormal WT + MO2-linc-tr Fig. 2Fig. 4 from Alcaraz-Pérez et al., 2014
nucleate erythrocyte radius, abnormal WT + MO2-linc-tr Fig. 5S from Alcaraz-Pérez et al., 2014
telomerase activity decreased process quality, abnormal WT + MO2-linc-tr Fig. 1 from Alcaraz-Pérez et al., 2014
Phenotype of all Fish created by or utilizing MO2-linc-tr
Phenotype Fish Conditions Figures
caudal hematopoietic tissue csf3a expression decreased amount, abnormal AB + MO2-linc-tr standard conditions Fig. S1 from García-Castillo et al., 2021
caudal hematopoietic tissue spi1b expression decreased amount, abnormal AB + MO2-linc-tr standard conditions Fig. S1 from García-Castillo et al., 2021
caudal hematopoietic tissue terc expression decreased amount, abnormal AB + MO2-linc-tr standard conditions Fig. S1 from García-Castillo et al., 2021
caudal hematopoietic tissue spi1a expression decreased amount, abnormal AB + MO2-linc-tr standard conditions Fig. S1 from García-Castillo et al., 2021
caudal hematopoietic tissue csf3b expression decreased amount, abnormal AB + MO2-linc-tr standard conditions Fig. S1 from García-Castillo et al., 2021
blood cell morphology, abnormal WT + MO2-linc-tr standard conditions Fig. 5S from Alcaraz-Pérez et al., 2014
myeloid cell spi1b expression decreased amount, abnormal WT + MO2-linc-tr standard conditions Fig. 4 from Alcaraz-Pérez et al., 2014
intermediate cell mass of mesoderm csf3r expression decreased amount, abnormal WT + MO2-linc-tr standard conditions Fig. 4 from Alcaraz-Pérez et al., 2014
nucleate erythrocyte radius, abnormal WT + MO2-linc-tr standard conditions Fig. 5S from Alcaraz-Pérez et al., 2014
intermediate cell mass of mesoderm spi1b expression decreased amount, abnormal WT + MO2-linc-tr standard conditions Fig. 4 from Alcaraz-Pérez et al., 2014
telomerase activity decreased process quality, abnormal WT + MO2-linc-tr standard conditions Fig. 1 from Alcaraz-Pérez et al., 2014
myeloid cell csf3r expression decreased amount, abnormal WT + MO2-linc-tr standard conditions Fig. 4 from Alcaraz-Pérez et al., 2014
neutrophil decreased amount, abnormal WT + MO2-linc-tr standard conditions Fig. 4 from Alcaraz-Pérez et al., 2014
cell chromosome, telomeric region decreased length, abnormal WT + MO2-linc-tr standard conditions Fig. 3 from Alcaraz-Pérez et al., 2014
macrophage decreased amount, abnormal gl23Tg + MO2-linc-tr standard conditions Fig. 2 from Alcaraz-Pérez et al., 2014
neutrophil decreased amount, abnormal nz50Tg + MO2-linc-tr standard conditions Fig. 2 from Alcaraz-Pérez et al., 2014
neutrophil decreased amount, abnormal terthu3430/hu3430 + MO2-linc-tr standard conditions Fig. 3 from Alcaraz-Pérez et al., 2014
cell chromosome, telomeric region decreased length, abnormal terthu3430/hu3430 + MO2-linc-tr standard conditions Fig. 3 from Alcaraz-Pérez et al., 2014
Citations