Morpholino

MO1-efhc2

ID
ZDB-MRPHLNO-190218-1
Name
MO1-efhc2
Previous Names
None
Target
Sequence
5' - GTTTGATTCTGATGGTTCACCTTGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-efhc2
No data available
Phenotype
Phenotype resulting from MO1-efhc2
Phenotype Fish Figures
brain hydrocephalic, abnormal WT + MO1-efhc2 Fig. 2 with image from Barrodia et al., 2018
corpuscles of Stannius stc1 expression decreased amount, abnormal WT + MO1-efhc2 Fig. 3 with imageFig. 4 with image from Barrodia et al., 2018
corpuscles of Stannius stc1 expression decreased distribution, abnormal WT + MO1-efhc2 Fig. 3 with imageFig. 4 with imageFig. 5 with image from Barrodia et al., 2018
corpuscles of Stannius mislocalised, abnormal WT + MO1-efhc2 Fig. 5 with image from Barrodia et al., 2018
corpuscles of Stannius stc1 expression mislocalised, abnormal WT + MO1-efhc2 Fig. 3 with imageFig. 4 with imageFig. 5 with imageFig. 6 with image from Barrodia et al., 2018
corpuscles of Stannius stc1 expression spatial pattern, abnormal WT + MO1-efhc2 Fig. 5 with image from Barrodia et al., 2018
pericardium edematous, abnormal WT + MO1-efhc2 Fig. 2 with image from Barrodia et al., 2018
pronephric distal early tubule slc12a1 expression increased distribution, abnormal WT + MO1-efhc2 Fig. 3 with imageFig. 4 with imageFig. 5 with imageFig. 6 with image from Barrodia et al., 2018
pronephric distal early tubule increased size, abnormal WT + MO1-efhc2 Fig. 3 with image from Barrodia et al., 2018
pronephric distal early tubule slc12a1 expression mislocalised, abnormal WT + MO1-efhc2 Fig. 3 with imageFig. 4 with imageFig. 5 with imageFig. 6 with image from Barrodia et al., 2018
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal WT + MO1-efhc2 Fig. 3 with imageFig. 4 with imageFig. 5 with imageFig. 6 with image from Barrodia et al., 2018
pronephric distal late tubule decreased size, abnormal WT + MO1-efhc2 Fig. 3 with image from Barrodia et al., 2018
pronephros decreased functionality, abnormal WT + MO1-efhc2 Fig. 2 with image from Barrodia et al., 2018
pronephros multi-ciliated epithelial cell decreased amount, abnormal WT + MO1-efhc2 Fig. 7 with image from Barrodia et al., 2018
pronephros multi-ciliated epithelial cell cimap1b expression decreased distribution, abnormal WT + MO1-efhc2 Fig. 7 with image from Barrodia et al., 2018
specification of pronephric distal tubule identity process quality, abnormal WT + MO1-efhc2 Fig. 3 with image from Barrodia et al., 2018
Phenotype of all Fish created by or utilizing MO1-efhc2
Phenotype Fish Conditions Figures
corpuscles of Stannius stc1 expression decreased distribution, abnormal WT + MO1-efhc2 control Fig. 3 with imageFig. 4 with imageFig. 5 with image from Barrodia et al., 2018
corpuscles of Stannius mislocalised, abnormal WT + MO1-efhc2 control Fig. 5 with image from Barrodia et al., 2018
corpuscles of Stannius stc1 expression mislocalised, abnormal WT + MO1-efhc2 chemical treatment by environment: 3-allyl-2-[2-(diethylamino)ethoxy]benzaldehyde Fig. 5 with image from Barrodia et al., 2018
pronephros decreased functionality, abnormal WT + MO1-efhc2 standard conditions Fig. 2 with image from Barrodia et al., 2018
pronephric distal early tubule slc12a1 expression increased distribution, abnormal WT + MO1-efhc2 chemical treatment by environment: retinoic acid Fig. 4 with image from Barrodia et al., 2018
corpuscles of Stannius stc1 expression mislocalised, abnormal WT + MO1-efhc2 control Fig. 3 with imageFig. 4 with imageFig. 5 with imageFig. 6 with image from Barrodia et al., 2018
pronephric distal late tubule slc12a3 expression increased distribution, abnormal WT + MO1-efhc2 chemical treatment by environment: 3-allyl-2-[2-(diethylamino)ethoxy]benzaldehyde Fig. 5 with image from Barrodia et al., 2018
pericardium edematous, abnormal WT + MO1-efhc2 standard conditions Fig. 2 with image from Barrodia et al., 2018
corpuscles of Stannius stc1 expression mislocalised, abnormal WT + MO1-efhc2 chemical treatment by environment: citral Fig. 6 with image from Barrodia et al., 2018
corpuscles of Stannius stc1 expression absent, abnormal WT + MO1-efhc2 chemical treatment by environment: retinoic acid Fig. 4 with image from Barrodia et al., 2018
corpuscles of Stannius stc1 expression spatial pattern, abnormal WT + MO1-efhc2 control Fig. 5 with image from Barrodia et al., 2018
pronephric distal late tubule slc12a3 expression spatial pattern, ameliorated WT + MO1-efhc2 chemical treatment by environment: citral Fig. 6 with image from Barrodia et al., 2018
pronephric distal early tubule slc12a1 expression mislocalised, abnormal WT + MO1-efhc2 control Fig. 3 with imageFig. 4 with imageFig. 5 with imageFig. 6 with image from Barrodia et al., 2018
corpuscles of Stannius stc1 expression decreased amount, abnormal WT + MO1-efhc2 control Fig. 3 with imageFig. 4 with image from Barrodia et al., 2018
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal WT + MO1-efhc2 control Fig. 3 with imageFig. 4 with imageFig. 5 with imageFig. 6 with image from Barrodia et al., 2018
pronephric distal early tubule slc12a1 expression mislocalised, abnormal WT + MO1-efhc2 chemical treatment by environment: 3-allyl-2-[2-(diethylamino)ethoxy]benzaldehyde Fig. 5 with image from Barrodia et al., 2018
pronephric distal late tubule slc12a3 expression decreased amount, abnormal WT + MO1-efhc2 chemical treatment by environment: retinoic acid Fig. 4 with image from Barrodia et al., 2018
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal WT + MO1-efhc2 chemical treatment by environment: retinoic acid Fig. 4 with image from Barrodia et al., 2018
pronephric distal early tubule slc12a1 expression mislocalised, abnormal WT + MO1-efhc2 chemical treatment by environment: citral Fig. 6 with image from Barrodia et al., 2018
pronephros multi-ciliated epithelial cell cimap1b expression mislocalised, abnormal WT + MO1-efhc2 chemical treatment by environment: retinoic acid Fig. 7 with image from Barrodia et al., 2018
pronephric distal early tubule slc12a1 expression spatial pattern, abnormal WT + MO1-efhc2 chemical treatment by environment: 3-allyl-2-[2-(diethylamino)ethoxy]benzaldehyde Fig. 5 with image from Barrodia et al., 2018
pronephros multi-ciliated epithelial cell cimap1b expression decreased distribution, abnormal WT + MO1-efhc2 chemical treatment by environment: 3-allyl-2-[2-(diethylamino)ethoxy]benzaldehyde Fig. 7 with image from Barrodia et al., 2018
pronephric distal late tubule decreased size, abnormal WT + MO1-efhc2 standard conditions Fig. 3 with image from Barrodia et al., 2018
pronephric distal early tubule slc12a1 expression increased distribution, abnormal WT + MO1-efhc2 control Fig. 3 with imageFig. 4 with imageFig. 5 with imageFig. 6 with image from Barrodia et al., 2018
pronephros multi-ciliated epithelial cell cimap1b expression decreased distribution, abnormal WT + MO1-efhc2 chemical treatment by environment: citral Fig. 7 with image from Barrodia et al., 2018
corpuscles of Stannius mislocalised, abnormal WT + MO1-efhc2 chemical treatment by environment: 3-allyl-2-[2-(diethylamino)ethoxy]benzaldehyde Fig. 5 with image from Barrodia et al., 2018
pronephric distal early tubule slc12a1 expression mislocalised, abnormal WT + MO1-efhc2 chemical treatment by environment: retinoic acid Fig. 4 with image from Barrodia et al., 2018
pronephros multi-ciliated epithelial cell decreased amount, abnormal WT + MO1-efhc2 control Fig. 7 with image from Barrodia et al., 2018
pronephros multi-ciliated epithelial cell cimap1b expression decreased distribution, abnormal WT + MO1-efhc2 control Fig. 7 with image from Barrodia et al., 2018
pronephric distal early tubule increased size, abnormal WT + MO1-efhc2 standard conditions Fig. 3 with image from Barrodia et al., 2018
pronephros multi-ciliated epithelial cell amount, ameliorated WT + MO1-efhc2 chemical treatment by environment: retinoic acid Fig. 7 with image from Barrodia et al., 2018
pronephros multi-ciliated epithelial cell cimap1b expression decreased distribution, abnormal WT + MO1-efhc2 chemical treatment by environment: retinoic acid Fig. 7 with image from Barrodia et al., 2018
pronephros multi-ciliated epithelial cell decreased amount, exacerbated WT + MO1-efhc2 chemical treatment by environment: 3-allyl-2-[2-(diethylamino)ethoxy]benzaldehyde Fig. 7 with image from Barrodia et al., 2018
brain hydrocephalic, abnormal WT + MO1-efhc2 standard conditions Fig. 2 with image from Barrodia et al., 2018
corpuscles of Stannius stc1 expression spatial pattern, abnormal WT + MO1-efhc2 chemical treatment by environment: 3-allyl-2-[2-(diethylamino)ethoxy]benzaldehyde Fig. 5 with image from Barrodia et al., 2018
pronephric distal late tubule slc12a3 expression mislocalised, abnormal WT + MO1-efhc2 chemical treatment by environment: retinoic acid Fig. 4 with image from Barrodia et al., 2018
pronephric distal late tubule slc12a3 expression increased amount, abnormal WT + MO1-efhc2 chemical treatment by environment: citral Fig. 6 with image from Barrodia et al., 2018
specification of pronephric distal tubule identity process quality, abnormal WT + MO1-efhc2 standard conditions Fig. 3 with image from Barrodia et al., 2018
pronephric distal early tubule slc12a1 expression increased distribution, abnormal WT + MO1-efhc2 chemical treatment by environment: citral Fig. 6 with image from Barrodia et al., 2018
Citations