Morpholino

MO1-pou6f1

ID
ZDB-MRPHLNO-190621-1
Name
MO1-pou6f1
Previous Names
None
Target
Sequence
5' - CTCAGTGTCCATGATGATGAAGTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pou6f1
No data available
Phenotype
Phenotype resulting from MO1-pou6f1
Phenotype Fish Figures
atrioventricular canal increased length, abnormal AB + MO1-pou6f1 Fig. 4 with image from Bhakta et al., 2018
atrioventricular canal malformed, abnormal AB + MO1-pou6f1 Fig. 4 with image from Bhakta et al., 2018
atrioventricular canal nppa expression mislocalised, abnormal AB + MO1-pou6f1 Fig. 5 with imageFig. 6 with image from Bhakta et al., 2018
atrioventricular canal cardiac muscle cell development decreased process quality, abnormal AB + MO1-pou6f1 Fig. 6 with image from Bhakta et al., 2018
atrioventricular canal myocardium bmp4 expression decreased amount, abnormal AB + MO1-pou6f1 Fig. 6 with image from Bhakta et al., 2018
atrioventricular canal myocardium vcana expression decreased amount, abnormal AB + MO1-pou6f1 Fig. 6 with image from Bhakta et al., 2018
atrioventricular canal morphogenesis decreased process quality, abnormal AB + MO1-pou6f1 Fig. 4 with imageFig. 6 with image from Bhakta et al., 2018
blood circulation decreased occurrence, abnormal AB + MO1-pou6f1 Fig. 3 with image from Bhakta et al., 2018
heart edematous, abnormal AB + MO1-pou6f1 Fig. 3 with imageFig. 4 with image from Bhakta et al., 2018
heart malformed, abnormal AB + MO1-pou6f1 Fig. 4 with image from Bhakta et al., 2018
heart contraction decreased frequency, abnormal AB + MO1-pou6f1 Fig. 3 with imageFig. 4 with image from Bhakta et al., 2018
heart looping decreased occurrence, abnormal AB + MO1-pou6f1 Fig. 4 with image from Bhakta et al., 2018
heart morphogenesis decreased process quality, abnormal AB + MO1-pou6f1 Fig. 4 with image from Bhakta et al., 2018
whole organism bmp4 expression decreased amount, abnormal AB + MO1-pou6f1 Fig. 4 with image from Bhakta et al., 2018
whole organism myh7 expression increased amount, abnormal AB + MO1-pou6f1 Fig. 4 with image from Bhakta et al., 2018
whole organism myh6 expression increased amount, abnormal AB + MO1-pou6f1 Fig. 4 with image from Bhakta et al., 2018
Phenotype of all Fish created by or utilizing MO1-pou6f1
Phenotype Fish Conditions Figures
whole organism myh6 expression increased amount, abnormal AB + MO1-pou6f1 standard conditions Fig. 4 with image from Bhakta et al., 2018
atrioventricular canal increased length, abnormal AB + MO1-pou6f1 standard conditions Fig. 4 with image from Bhakta et al., 2018
blood circulation decreased occurrence, abnormal AB + MO1-pou6f1 standard conditions Fig. 3 with image from Bhakta et al., 2018
heart looping decreased occurrence, abnormal AB + MO1-pou6f1 standard conditions Fig. 4 with image from Bhakta et al., 2018
atrioventricular canal myocardium bmp4 expression decreased amount, abnormal AB + MO1-pou6f1 standard conditions Fig. 6 with image from Bhakta et al., 2018
heart malformed, abnormal AB + MO1-pou6f1 standard conditions Fig. 4 with image from Bhakta et al., 2018
heart morphogenesis decreased process quality, abnormal AB + MO1-pou6f1 standard conditions Fig. 4 with image from Bhakta et al., 2018
atrioventricular canal morphogenesis decreased process quality, abnormal AB + MO1-pou6f1 standard conditions Fig. 4 with imageFig. 6 with image from Bhakta et al., 2018
heart contraction decreased frequency, abnormal AB + MO1-pou6f1 standard conditions Fig. 3 with imageFig. 4 with image from Bhakta et al., 2018
whole organism myh7 expression increased amount, abnormal AB + MO1-pou6f1 standard conditions Fig. 4 with image from Bhakta et al., 2018
whole organism bmp4 expression decreased amount, abnormal AB + MO1-pou6f1 standard conditions Fig. 4 with image from Bhakta et al., 2018
atrioventricular canal myocardium vcana expression decreased amount, abnormal AB + MO1-pou6f1 standard conditions Fig. 6 with image from Bhakta et al., 2018
atrioventricular canal malformed, abnormal AB + MO1-pou6f1 standard conditions Fig. 4 with image from Bhakta et al., 2018
heart edematous, abnormal AB + MO1-pou6f1 standard conditions Fig. 3 with imageFig. 4 with image from Bhakta et al., 2018
atrioventricular canal cardiac muscle cell development decreased process quality, abnormal AB + MO1-pou6f1 standard conditions Fig. 6 with image from Bhakta et al., 2018
atrioventricular canal nppa expression mislocalised, abnormal AB + MO1-pou6f1 standard conditions Fig. 5 with imageFig. 6 with image from Bhakta et al., 2018
Citations