Morpholino

MO1-qdprb.1

ID
ZDB-MRPHLNO-190828-5
Name
MO1-qdprb.1
Previous Names
  • MO1-qdprb1
Target
Sequence
5' - TATTAGGCGAGTACCAACTTTTGGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-qdprb.1
No data available
Phenotype
Phenotype resulting from MO1-qdprb.1
Phenotype Fish Figures
brain decreased size, abnormal knu3Tg + MO1-qdprb.1 Fig. 2 with imageFig. 4 with image from Breuer et al., 2019
brain development disrupted, abnormal AB + MO1-qdprb.1 Fig. 2 with imageFig. S3 with image from Breuer et al., 2019
eye glula expression absent, abnormal AB + MO1-qdprb.1 Fig. 5 with image from Breuer et al., 2019
eye slc1a2b expression decreased amount, abnormal AB + MO1-qdprb.1 Fig. 5 with image from Breuer et al., 2019
eye decreased size, abnormal knu3Tg + MO1-qdprb.1 Fig. 4 with image from Breuer et al., 2019
eye cell population proliferation increased process quality, abnormal knu3Tg + MO1-qdprb.1 Fig. 4 with image from Breuer et al., 2019
head decreased size, abnormal AB + MO1-qdprb.1 + MO4-tp53 Fig. 2 with imageFig. S3 with image from Breuer et al., 2019
hindbrain glula expression decreased amount, abnormal AB + MO1-qdprb.1 Fig. 5 with image from Breuer et al., 2019
hindbrain morphology, abnormal AB + MO1-qdprb.1 Fig. 2 with imageFig. S3 with image from Breuer et al., 2019
midbrain slc1a2b expression decreased amount, abnormal AB + MO1-qdprb.1 Fig. 5 with image from Breuer et al., 2019
midbrain glula expression decreased amount, abnormal AB + MO1-qdprb.1 Fig. 5 with image from Breuer et al., 2019
midbrain morphology, abnormal AB + MO1-qdprb.1 + MO4-tp53 Fig. 2 with imageFig. S3 with image from Breuer et al., 2019
optic tectum decreased size, abnormal knu3Tg + MO1-qdprb.1 Fig. 4 with image from Breuer et al., 2019
optic tectum cell population proliferation increased process quality, abnormal knu3Tg + MO1-qdprb.1 Fig. 4 with image from Breuer et al., 2019
retinal outer nuclear layer slc1a2a expression decreased amount, abnormal AB + MO1-qdprb.1 Fig. 5 with image from Breuer et al., 2019
whole organism slc38a2 expression decreased amount, abnormal AB + MO1-qdprb.1 Fig. S6 with image from Breuer et al., 2019
whole organism slc1a2a expression decreased amount, abnormal AB + MO1-qdprb.1 Fig. 5 with image from Breuer et al., 2019
whole organism gfap expression decreased amount, abnormal AB + MO1-qdprb.1 Fig. 5 with image from Breuer et al., 2019
whole organism glula expression decreased amount, abnormal AB + MO1-qdprb.1 Fig. 5 with image from Breuer et al., 2019
whole organism glutamine increased amount, abnormal AB + MO1-qdprb.1 Fig. 3Fig. S4 from Breuer et al., 2019
Phenotype of all Fish created by or utilizing MO1-qdprb.1
Phenotype Fish Conditions Figures
brain decreased size, abnormal AB + MO1-qdprb.1 standard conditions Fig. 2 with image from Breuer et al., 2019
whole organism slc38a2 expression decreased amount, abnormal AB + MO1-qdprb.1 control Fig. S6 with image from Breuer et al., 2019
whole organism gfap expression decreased amount, abnormal AB + MO1-qdprb.1 control Fig. 5 with image from Breuer et al., 2019
hindbrain glula expression decreased amount, abnormal AB + MO1-qdprb.1 control Fig. 5 with image from Breuer et al., 2019
retinal outer nuclear layer slc1a2a expression decreased amount, abnormal AB + MO1-qdprb.1 control Fig. 5 with image from Breuer et al., 2019
head decreased size, abnormal AB + MO1-qdprb.1 standard conditions Fig. 2 with image from Breuer et al., 2019
whole organism glula expression decreased amount, abnormal AB + MO1-qdprb.1 control Fig. 5 with image from Breuer et al., 2019
eye glula expression absent, abnormal AB + MO1-qdprb.1 control Fig. 5 with image from Breuer et al., 2019
midbrain slc1a2b expression decreased amount, abnormal AB + MO1-qdprb.1 control Fig. 5 with image from Breuer et al., 2019
hindbrain morphology, abnormal AB + MO1-qdprb.1 standard conditions Fig. 2 with image from Breuer et al., 2019
whole organism glutamine increased amount, abnormal AB + MO1-qdprb.1 standard conditions Fig. 3 from Breuer et al., 2019
brain development disrupted, abnormal AB + MO1-qdprb.1 standard conditions Fig. 2 with image from Breuer et al., 2019
whole organism slc1a2a expression decreased amount, abnormal AB + MO1-qdprb.1 control Fig. 5 with image from Breuer et al., 2019
midbrain glula expression decreased amount, abnormal AB + MO1-qdprb.1 control Fig. 5 with image from Breuer et al., 2019
midbrain morphology, abnormal AB + MO1-qdprb.1 standard conditions Fig. 2 with image from Breuer et al., 2019
eye slc1a2b expression decreased amount, abnormal AB + MO1-qdprb.1 control Fig. 5 with image from Breuer et al., 2019
head decreased size, abnormal AB + MO1-qdprb.1 + MO4-tp53 standard conditions Fig. S3 with image from Breuer et al., 2019
hindbrain morphology, abnormal AB + MO1-qdprb.1 + MO4-tp53 standard conditions Fig. S3 with image from Breuer et al., 2019
whole organism glutamine increased amount, abnormal AB + MO1-qdprb.1 + MO4-tp53 standard conditions Fig. S4 from Breuer et al., 2019
brain development disrupted, abnormal AB + MO1-qdprb.1 + MO4-tp53 standard conditions Fig. S3 with image from Breuer et al., 2019
midbrain morphology, abnormal AB + MO1-qdprb.1 + MO4-tp53 standard conditions Fig. S3 with image from Breuer et al., 2019
eye decreased size, abnormal knu3Tg + MO1-qdprb.1 standard conditions Fig. 4 with image from Breuer et al., 2019
eye cell population proliferation increased process quality, abnormal knu3Tg + MO1-qdprb.1 standard conditions Fig. 4 with image from Breuer et al., 2019
optic tectum decreased size, abnormal knu3Tg + MO1-qdprb.1 standard conditions Fig. 4 with image from Breuer et al., 2019
optic tectum cell population proliferation increased process quality, abnormal knu3Tg + MO1-qdprb.1 standard conditions Fig. 4 with image from Breuer et al., 2019
brain decreased size, abnormal knu3Tg + MO1-qdprb.1 standard conditions Fig. 4 with image from Breuer et al., 2019
Citations