Morpholino

MO1-ttc19

ID

ZDB-MRPHLNO-200124-4

Name

MO1-ttc19

Previous Names

None

Target

ttc19 (1)

Sequence

5' - AAGGCTGATGTGAAAGCAAATCTGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-ttc19

No data available

Phenotype

Phenotype resulting from MO1-ttc19

Phenotype	Fish	Figures
aerobic respiration decreased occurrence, abnormal	TU + MO1-ttc19	Fig. 1 from Peruzzo et al., 2021 Fig. 3 from Costa et al., 2019
canonical Wnt signaling pathway decreased occurrence, abnormal	ia4Tg + MO1-ttc19	Fig. 3 , Fig. 4 from Costa et al., 2019
caudal fin morphology, abnormal	WT + MO1-ttc19	Fig. 3 from Costa et al., 2019
post-vent region malformed, abnormal	TU + MO1-ttc19	Fig. 1 from Peruzzo et al., 2021
splanchnocranium morphology, abnormal	WT + MO1-ttc19	Fig. 3 from Costa et al., 2019
thigmotaxis decreased process quality, abnormal	TU + MO1-ttc19	Fig. 1 from Peruzzo et al., 2021
whole organism GFP expression decreased amount, abnormal	ia4Tg + MO1-ttc19	Fig. 3 , Fig. 4 from Costa et al., 2019
whole organism decreased length, abnormal	TU + MO1-ttc19	Fig. 1 from Peruzzo et al., 2021 Fig. 3 , Fig. 4 from Costa et al., 2019
whole organism decreased pigmentation, abnormal	WT + MO1-ttc19	Fig. 3 from Costa et al., 2019

Phenotype of all Fish created by or utilizing MO1-ttc19

Phenotype	Fish	Conditions	Figures
whole organism length, ameliorated	TU + MO1-ttc19	chemical treatment by environment: pyocyanine	Fig. 1 from Peruzzo et al., 2021
post-vent region malformed, abnormal	TU + MO1-ttc19	control	Fig. 1 from Peruzzo et al., 2021
thigmotaxis decreased process quality, abnormal	TU + MO1-ttc19	control	Fig. 1 from Peruzzo et al., 2021
thigmotaxis process quality, ameliorated	TU + MO1-ttc19	chemical treatment by environment: pyocyanine	Fig. 1 from Peruzzo et al., 2021
aerobic respiration occurrence, ameliorated	TU + MO1-ttc19	chemical treatment by environment: pyocyanine	Fig. 1 from Peruzzo et al., 2021
post-vent region morphology, ameliorated	TU + MO1-ttc19	chemical treatment by environment: pyocyanine	Fig. 1 from Peruzzo et al., 2021
whole organism decreased length, abnormal	TU + MO1-ttc19	control	Fig. 1 from Peruzzo et al., 2021
aerobic respiration decreased occurrence, abnormal	TU + MO1-ttc19	control	Fig. 1 from Peruzzo et al., 2021
whole organism decreased length, abnormal	WT + MO1-ttc19	control	Fig. 3 from Costa et al., 2019
aerobic respiration decreased occurrence, abnormal	WT + MO1-ttc19	control	Fig. 3 from Costa et al., 2019
caudal fin morphology, abnormal	WT + MO1-ttc19	control	Fig. 3 from Costa et al., 2019
whole organism decreased pigmentation, abnormal	WT + MO1-ttc19	control	Fig. 3 from Costa et al., 2019
splanchnocranium morphology, abnormal	WT + MO1-ttc19	control	Fig. 3 from Costa et al., 2019
whole organism decreased length, abnormal	ia4Tg + MO1-ttc19	control	Fig. 4 from Costa et al., 2019
whole organism GFP expression decreased amount, abnormal	ia4Tg + MO1-ttc19	control	Fig. 3 , Fig. 4 from Costa et al., 2019
canonical Wnt signaling pathway decreased occurrence, abnormal	ia4Tg + MO1-ttc19	control	Fig. 3 , Fig. 4 from Costa et al., 2019
whole organism length, ameliorated	ia4Tg + MO1-ttc19	chemical treatment by injection: creatine	Fig. 4 from Costa et al., 2019
canonical Wnt signaling pathway occurrence, ameliorated	ia4Tg + MO1-ttc19	chemical treatment by injection: creatine	Fig. 4 from Costa et al., 2019
whole organism GFP expression amount, ameliorated	ia4Tg + MO1-ttc19	chemical treatment by injection: creatine	Fig. 4 from Costa et al., 2019

Citations