Morpholino

MO2-ccn1l2

ID
ZDB-MRPHLNO-200304-5
Name
MO2-ccn1l2
Previous Names
None
Target
Sequence
5' - TCCTCTGATTTCTTCCAGAATGCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ccn1l2
No data available
Phenotype
Phenotype resulting from MO2-ccn1l2
Phenotype Fish Figures
cranial vasculature sprouting angiogenesis process quality, abnormal s843Tg + MO2-ccn1l2 Figure 1 with image from Park et al., 2019
dorsal aorta notch1b expression decreased amount, abnormal AB + MO2-ccn1l2 Figure 1 figure supplement 1 with image from Park et al., 2019
dorsal aorta flt4 expression mislocalised, abnormal AB + MO2-ccn1l2 Figure 1 figure supplement 1 with image from Park et al., 2019
dorsal longitudinal anastomotic vessel morphology, abnormal s843Tg + MO2-ccn1l2 Figure 1 with image from Park et al., 2019
head decreased size, abnormal s843Tg + MO2-ccn1l2 Figure 1 with image from Park et al., 2019
intersegmental vessel branchiness, abnormal s843Tg + MO2-ccn1l2 Figure 1 with image from Park et al., 2019
intersegmental vessel notch1b expression decreased amount, abnormal AB + MO2-ccn1l2 Figure 1 figure supplement 1 with image from Park et al., 2019
intersegmental vessel detached from dorsal longitudinal anastomotic vessel, abnormal s843Tg + MO2-ccn1l2 Figure 1 with image from Park et al., 2019
intersegmental vessel morphology, abnormal s843Tg + MO2-ccn1l2 Figure 1 with image from Park et al., 2019
pericardial region edematous, abnormal s843Tg + MO2-ccn1l2 Figure 1 with image from Park et al., 2019
trunk bent, abnormal s843Tg + MO2-ccn1l2 Figure 1 with image from Park et al., 2019
trunk fli1 expression spatial pattern, abnormal AB + MO2-ccn1l2 Figure 1 with image from Park et al., 2019
trunk vasculature sprouting angiogenesis process quality, abnormal s843Tg + MO2-ccn1l2 Figure 1 with image from Park et al., 2019
whole organism anterior-posterior axis fli1 expression increased amount, abnormal AB + MO2-ccn1l2 Figure 1 with image from Park et al., 2019
whole organism anterior-posterior axis fli1 expression mislocalised, abnormal AB + MO2-ccn1l2 Figure 1 with image from Park et al., 2019
Phenotype of all Fish created by or utilizing MO2-ccn1l2
Phenotype Fish Conditions Figures
dorsal aorta flt4 expression mislocalised, abnormal AB + MO2-ccn1l2 standard conditions Figure 1 figure supplement 1 with image from Park et al., 2019
intersegmental vessel notch1b expression decreased amount, abnormal AB + MO2-ccn1l2 standard conditions Figure 1 figure supplement 1 with image from Park et al., 2019
whole organism anterior-posterior axis fli1 expression mislocalised, abnormal AB + MO2-ccn1l2 standard conditions Figure 1 with image from Park et al., 2019
whole organism anterior-posterior axis fli1 expression increased amount, abnormal AB + MO2-ccn1l2 standard conditions Figure 1 with image from Park et al., 2019
dorsal aorta notch1b expression decreased amount, abnormal AB + MO2-ccn1l2 standard conditions Figure 1 figure supplement 1 with image from Park et al., 2019
trunk fli1 expression spatial pattern, abnormal AB + MO2-ccn1l2 standard conditions Figure 1 with image from Park et al., 2019
trunk vasculature sprouting angiogenesis process quality, abnormal s843Tg + MO2-ccn1l2 standard conditions Figure 1 with image from Park et al., 2019
trunk bent, abnormal s843Tg + MO2-ccn1l2 standard conditions Figure 1 with image from Park et al., 2019
pericardial region edematous, abnormal s843Tg + MO2-ccn1l2 standard conditions Figure 1 with image from Park et al., 2019
intersegmental vessel branchiness, abnormal s843Tg + MO2-ccn1l2 standard conditions Figure 1 with image from Park et al., 2019
dorsal longitudinal anastomotic vessel morphology, abnormal s843Tg + MO2-ccn1l2 standard conditions Figure 1 with image from Park et al., 2019
head decreased size, abnormal s843Tg + MO2-ccn1l2 standard conditions Figure 1 with image from Park et al., 2019
intersegmental vessel detached from dorsal longitudinal anastomotic vessel, abnormal s843Tg + MO2-ccn1l2 standard conditions Figure 1 with image from Park et al., 2019
cranial vasculature sprouting angiogenesis process quality, abnormal s843Tg + MO2-ccn1l2 standard conditions Figure 1 with image from Park et al., 2019
intersegmental vessel morphology, abnormal s843Tg + MO2-ccn1l2 standard conditions Figure 1 with image from Park et al., 2019
Citations