Morpholino

MO1-fndc3a

ID
ZDB-MRPHLNO-200313-1
Name
MO1-fndc3a
Previous Names
  • MO1-fncd3a
Target
Sequence
5' - GCGTTCTGAGCAATACACACCTGAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fndc3a
No data available
Phenotype
Phenotype resulting from MO1-fndc3a
Phenotype of all Fish created by or utilizing MO1-fndc3a
Phenotype Fish Conditions Figures
caudal fin kinked, abnormal fndc3awue1/wue1 + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold hmcn1 expression decreased amount, abnormal fndc3awue1/wue1 + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold fras1 expression decreased amount, abnormal fndc3awue1/wue1 + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold mesenchyme hmcn2 expression decreased amount, abnormal fndc3awue1/wue1 + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold mesenchyme fras1 expression decreased amount, abnormal fndc3awue1/wue1 + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold hmcn2 expression decreased amount, abnormal fndc3awue1/wue1 + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
caudal fin deformed, abnormal fndc3awue1/wue1 + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold decreased width, abnormal fndc3awue1/wue1 + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold mesenchyme hmcn1 expression decreased amount, abnormal fndc3awue1/wue1 + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold mesenchyme hmcn2 expression decreased amount, abnormal WT + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold hmcn1 expression decreased amount, abnormal WT + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold fras1 expression decreased amount, abnormal WT + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
caudal fin deformed, abnormal WT + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold mesenchyme fras1 expression decreased amount, abnormal WT + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold decreased width, abnormal WT + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold hmcn2 expression decreased amount, abnormal WT + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold mesenchyme hmcn1 expression decreased amount, abnormal WT + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
Citations