Morpholino

MO1-arl4aa

ID
ZDB-MRPHLNO-201015-1
Name
MO1-arl4aa
Previous Names
None
Target
Sequence
5' - TATCCCGTTCCCCATTTCCTTCAGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-arl4aa
No data available
Phenotype
Phenotype resulting from MO1-arl4aa
Phenotype Fish Figures
caudal hematopoietic tissue myb expression decreased distribution, abnormal WT + MO1-arl4aa Fig. 2 with image from Guo et al., 2020
dorsal aorta myb expression decreased distribution, abnormal WT + MO1-arl4aa Fig. 2 with image from Guo et al., 2020
thymus rag1 expression decreased distribution, abnormal WT + MO1-arl4aa Fig. 2 with image from Guo et al., 2020
trunk vasculature EGFP expression decreased distribution, abnormal ci5Tg; um14Tg + MO1-arl4aa Fig. 6 with image from Guo et al., 2020
ventral wall of dorsal aorta runx1 expression decreased distribution, abnormal WT + MO1-arl4aa Fig. 2 with image from Guo et al., 2020
ventral wall of dorsal aorta myb expression decreased distribution, abnormal kca4Tg + MO1-arl4aa Fig. 6 with image from Guo et al., 2020
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal WT + MO1-arl4aa Fig. 2 with image from Guo et al., 2020
ventral wall of dorsal aorta perinuclear region of cytoplasm AB2-glogb1 labeling spatial pattern, abnormal ci5Tg + MO1-arl4aa Fig. 5 with image from Guo et al., 2020
whole organism her5 expression decreased amount, abnormal WT + MO1-arl4aa Fig. 6 with image from Guo et al., 2020
whole organism gata2a expression decreased amount, abnormal WT + MO1-arl4aa Fig. 6 with image from Guo et al., 2020
whole organism gata2b expression decreased amount, abnormal WT + MO1-arl4aa Fig. 6 with image from Guo et al., 2020
whole organism hey2 expression decreased amount, abnormal WT + MO1-arl4aa Fig. 6 with image from Guo et al., 2020
whole organism notch1a expression increased amount, abnormal WT + MO1-arl4aa Fig. 6 with image from Guo et al., 2020
whole organism notch3 expression increased amount, abnormal WT + MO1-arl4aa Fig. 6 with image from Guo et al., 2020
Phenotype of all Fish created by or utilizing MO1-arl4aa
Phenotype Fish Conditions Figures
caudal hematopoietic tissue myb expression decreased distribution, abnormal WT + MO1-arl4aa standard conditions Fig. 2 with image from Guo et al., 2020
whole organism gata2b expression decreased amount, abnormal WT + MO1-arl4aa standard conditions Fig. 6 with image from Guo et al., 2020
ventral wall of dorsal aorta runx1 expression decreased distribution, abnormal WT + MO1-arl4aa standard conditions Fig. 2 with image from Guo et al., 2020
whole organism her5 expression decreased amount, abnormal WT + MO1-arl4aa standard conditions Fig. 6 with image from Guo et al., 2020
whole organism notch1a expression increased amount, abnormal WT + MO1-arl4aa standard conditions Fig. 6 with image from Guo et al., 2020
thymus rag1 expression decreased distribution, abnormal WT + MO1-arl4aa standard conditions Fig. 2 with image from Guo et al., 2020
whole organism hey2 expression decreased amount, abnormal WT + MO1-arl4aa standard conditions Fig. 6 with image from Guo et al., 2020
ventral wall of dorsal aorta hematopoietic stem cell decreased amount, abnormal WT + MO1-arl4aa standard conditions Fig. 2 with image from Guo et al., 2020
whole organism notch3 expression increased amount, abnormal WT + MO1-arl4aa standard conditions Fig. 6 with image from Guo et al., 2020
whole organism gata2a expression decreased amount, abnormal WT + MO1-arl4aa standard conditions Fig. 6 with image from Guo et al., 2020
dorsal aorta myb expression decreased distribution, abnormal WT + MO1-arl4aa standard conditions Fig. 2 with image from Guo et al., 2020
ventral wall of dorsal aorta perinuclear region of cytoplasm AB2-glogb1 labeling spatial pattern, abnormal ci5Tg + MO1-arl4aa standard conditions Fig. 5 with image from Guo et al., 2020
ventral wall of dorsal aorta myb expression decreased distribution, abnormal kca4Tg + MO1-arl4aa heat shock Fig. 6 with image from Guo et al., 2020
trunk vasculature EGFP expression decreased distribution, abnormal ci5Tg; um14Tg + MO1-arl4aa standard conditions Fig. 6 with image from Guo et al., 2020
ventral wall of dorsal aorta myb expression increased amount, abnormal kca3Tg; kca4Tg + MO1-arl4aa heat shock Fig. 6 with image from Guo et al., 2020
ventral wall of dorsal aorta myb expression decreased distribution, abnormal kca3Tg; kca4Tg + MO1-arl4aa standard conditions Fig. 6 with image from Guo et al., 2020
Citations