Morpholino
MO1-cby1
- ID
- ZDB-MRPHLNO-220111-2
- Name
- MO1-cby1
- Previous Names
- 
    
        
    
    
        
        - TB-MO (1)
 
- Target
- Sequence
- 
    
        
        
    
        
            
                5' - GTCTGACTTCTTAACCAAACGTGGA - 3'
                
            
            
                
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
                
                    
                        Target Location
                    
                    
                
                
            
        
        
    
        
            
            
        
        
    
    
    
                
                    
                        Genomic Features
                    
                    
                
                
            
        
        
    
        
            
            
    
    
        
    
No data available
    
        
        
    
    
    
                
                    
                        Expression
                    
                    
                
                
            
        
        
    
        
            
            
    
    
                
                    
                        Gene expression in Wild Types + MO1-cby1
                    
                    
                
                
            
        
        
    
        
            
                
    
    
        
    
No data available
    
            
        
    
    
    
                
                    
                        Phenotype
                    
                    
                
                
            
        
        
    
        
            
            
    
    
                
                    
                        Phenotype resulting from MO1-cby1
                    
                    
                
                
            
        
        
    
        
            
                
    
        
    
                
                    
                        Phenotype of all Fish created by or utilizing MO1-cby1
                    
                    
                
                
            
        
        
    
        
            
                
    
        
    | Phenotype | Fish | Conditions | Figures | 
|---|---|---|---|
| whole organism Ab1-cby1 labeling decreased amount, abnormal | li1Tg + MO1-cby1 + MO4-tp53 (AB/TL) | control | Fig. S2
                    
                    from Epting et al., 2020 | 
| pronephric duct cystic, abnormal | li1Tg + MO1-cby1 + MO4-tp53 (AB/TL) | control | Figure 2  from Epting et al., 2020 | 
| trunk curved, abnormal | li1Tg + MO1-cby1 + MO4-tp53 (AB/TL) | control | Figure 2  from Epting et al., 2020 | 
                
                    
                        Citations
                    
                    
                
                
            
        
        
    
        
            
            
        
        
    
    
    