Morpholino

MO4-lmo4a

ID
ZDB-MRPHLNO-240726-1
Name
MO4-lmo4a
Previous Names
None
Target
Sequence
5' - ACACTGGAGGAGAAAAACCAAGCGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-lmo4a
No data available
Phenotype
Phenotype resulting from MO4-lmo4a
Phenotype Fish Figures
embryonic structure eya1 expression decreased amount, abnormal TU + MO4-lmo4a Figure 5 with image from Sun et al., 2023
otic epithelium increased thickness, abnormal TU + MO4-lmo4a Figure 3 with image from Sun et al., 2023
otic vesicle decreased size, abnormal TU + MO4-lmo4a Figure 3 with image from Sun et al., 2023
otic vesicle bmp2b expression increased distribution, abnormal TU + MO4-lmo4a Figure 5 with image from Sun et al., 2023
otic vesicle bmp4 expression increased distribution, abnormal TU + MO4-lmo4a Figure 5 with image from Sun et al., 2023
otic vesicle bmp4 expression mislocalised, abnormal TU + MO4-lmo4a Figure 5 with image from Sun et al., 2023
otic vesicle bmp2b expression mislocalised, abnormal TU + MO4-lmo4a Figure 5 with image from Sun et al., 2023
otic vesicle development process quality, abnormal TU + MO4-lmo4a Figure 3 with image from Sun et al., 2023
saccule hair cell decreased amount, abnormal TU + MO4-lmo4a Figure 3 with image from Sun et al., 2023
semicircular canal morphology, abnormal TU + MO4-lmo4a Figure 3 with image from Sun et al., 2023
semicircular canal development disrupted, abnormal TU + MO4-lmo4a Figure 3 with image from Sun et al., 2023
statoacoustic (VIII) ganglion decreased area, abnormal TU + MO4-lmo4a Figure 3 with image from Sun et al., 2023
utricle hair cell decreased amount, abnormal TU + MO4-lmo4a Figure 3 with image from Sun et al., 2023
Phenotype of all Fish created by or utilizing MO4-lmo4a
Phenotype Fish Conditions Figures
embryonic structure eya1 expression decreased amount, abnormal TU + MO4-lmo4a standard conditions Figure 5 with image from Sun et al., 2023
semicircular canal development disrupted, abnormal TU + MO4-lmo4a standard conditions Figure 3 with image from Sun et al., 2023
otic vesicle bmp2b expression increased distribution, abnormal TU + MO4-lmo4a standard conditions Figure 5 with image from Sun et al., 2023
otic vesicle development process quality, abnormal TU + MO4-lmo4a standard conditions Figure 3 with image from Sun et al., 2023
utricle hair cell decreased amount, abnormal TU + MO4-lmo4a standard conditions Figure 3 with image from Sun et al., 2023
semicircular canal morphology, abnormal TU + MO4-lmo4a standard conditions Figure 3 with image from Sun et al., 2023
otic vesicle decreased size, abnormal TU + MO4-lmo4a standard conditions Figure 3 with image from Sun et al., 2023
semicircular canal morphology, ameliorated TU + MO4-lmo4a chemical treatment by injection: dorsomorphin Figure 5 with image from Sun et al., 2023
otic epithelium increased thickness, abnormal TU + MO4-lmo4a standard conditions Figure 3 with image from Sun et al., 2023
otic vesicle bmp2b expression mislocalised, abnormal TU + MO4-lmo4a standard conditions Figure 5 with image from Sun et al., 2023
statoacoustic (VIII) ganglion decreased area, abnormal TU + MO4-lmo4a standard conditions Figure 3 with image from Sun et al., 2023
otic vesicle bmp4 expression increased distribution, abnormal TU + MO4-lmo4a standard conditions Figure 5 with image from Sun et al., 2023
otic vesicle bmp4 expression mislocalised, abnormal TU + MO4-lmo4a standard conditions Figure 5 with image from Sun et al., 2023
saccule hair cell decreased amount, abnormal TU + MO4-lmo4a standard conditions Figure 3 with image from Sun et al., 2023
semicircular canal morphology, ameliorated w30Tg + MO4-lmo4a heat shock Figure 5 with image from Sun et al., 2023
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.