Transcript
mir430c-001
- ID
- ZDB-TSCRIPT-090929-23375
- Name
- mir430c-001 Nomenclature History
- Previous Names
- None
- Transcript Type
- miRNA
- Annotation Status
- miRBASE
- Annotation Method
- Associated With Genes
-
- dre-mir-430c-7 (1)
- dre-mir-430c-8 (1)
- dre-mir-430c-9 (1)
- dre-mir-430c-10 (1)
- dre-mir-430c-11 (1)
- dre-mir-430c-12 (1)
- dre-mir-430c-13 (1)
- dre-mir-430c-14 (1)
- dre-mir-430c-15 (1)
- dre-mir-430c-16 (1)
- dre-mir-430c-17 (1)
- dre-mir-430c-18 (1)
- mir430c-1 (1)
- mir430c-2 (1)
- mir430c-3 (1)
- mir430c-4 (1)
- mir430c-5 (1)
- mir430c-6 (1)
- Strain
- Non Reference Strain
- Genome Resources
- RNA Central
- None
- Note
- None
Sequence
| MIMAT0001425 (1) [ Show ] (double-click sequence to select) | [Download] |
>lcl|MIMAT0001425|ZDB-TSCRIPT-090929-23375 LoadedMicroRNAMature mir430c-001 miRNA 22bp TAAGTGCTTCTCTTTGGGGTAG
Related Transcripts
Transcripts related to dre-mir-430c-7
| Type | Name | Annotation Method | Has Havana Data | Length (nt) | Analysis |
|---|---|---|---|---|---|
| mRNA | dre-mir-430c-7-201 (1) | Ensembl | 73 nt | ||
| miRNA | mir430c-001 | 22 nt |
Transcripts related to dre-mir-430c-8
No other transcripts related to dre-mir-430c-8
Transcripts related to dre-mir-430c-9
No other transcripts related to dre-mir-430c-9
Transcripts related to dre-mir-430c-10
| Type | Name | Annotation Method | Has Havana Data | Length (nt) | Analysis |
|---|---|---|---|---|---|
| mRNA | dre-mir-430c-10-201 (1) | Ensembl | 73 nt | ||
| miRNA | mir430c-001 | 22 nt |
Transcripts related to dre-mir-430c-11
| Type | Name | Annotation Method | Has Havana Data | Length (nt) | Analysis |
|---|---|---|---|---|---|
| mRNA | dre-mir-430c-11-201 (1) | Ensembl | 73 nt | ||
| miRNA | mir430c-001 | 22 nt |
Transcripts related to dre-mir-430c-12
| Type | Name | Annotation Method | Has Havana Data | Length (nt) | Analysis |
|---|---|---|---|---|---|
| mRNA | dre-mir-430c-12-201 (1) | Ensembl | 73 nt | ||
| miRNA | mir430c-001 | 22 nt |
Transcripts related to dre-mir-430c-13
| Type | Name | Annotation Method | Has Havana Data | Length (nt) | Analysis |
|---|---|---|---|---|---|
| mRNA | dre-mir-430c-13-201 (1) | Ensembl | 73 nt | ||
| miRNA | mir430c-001 | 22 nt |
Transcripts related to dre-mir-430c-14
| Type | Name | Annotation Method | Has Havana Data | Length (nt) | Analysis |
|---|---|---|---|---|---|
| mRNA | dre-mir-430c-14-201 (1) | Ensembl | 73 nt | ||
| miRNA | mir430c-001 | 22 nt |
Transcripts related to dre-mir-430c-15
| Type | Name | Annotation Method | Has Havana Data | Length (nt) | Analysis |
|---|---|---|---|---|---|
| mRNA | dre-mir-430c-15-201 (1) | Ensembl | 73 nt | ||
| miRNA | mir430c-001 | 22 nt |
Transcripts related to dre-mir-430c-16
| Type | Name | Annotation Method | Has Havana Data | Length (nt) | Analysis |
|---|---|---|---|---|---|
| mRNA | dre-mir-430c-16-201 (1) | Ensembl | 73 nt | ||
| miRNA | mir430c-001 | 22 nt |
Transcripts related to dre-mir-430c-17
| Type | Name | Annotation Method | Has Havana Data | Length (nt) | Analysis |
|---|---|---|---|---|---|
| mRNA | dre-mir-430c-17-201 (1) | Ensembl | 73 nt | ||
| miRNA | mir430c-001 | 22 nt |
Transcripts related to dre-mir-430c-18
| Type | Name | Annotation Method | Has Havana Data | Length (nt) | Analysis |
|---|---|---|---|---|---|
| mRNA | dre-mir-430c-18-201 (1) | Ensembl | 73 nt | ||
| miRNA | mir430c-001 | 22 nt |
Transcripts related to mir430c-1
| Type | Name | Annotation Method | Has Havana Data | Length (nt) | Analysis |
|---|---|---|---|---|---|
| mRNA | mir430c-1-201 (1) | Ensembl | 73 nt | ||
| miRNA | mir430c-001 | 22 nt |
Transcripts related to mir430c-2
| Type | Name | Annotation Method | Has Havana Data | Length (nt) | Analysis |
|---|---|---|---|---|---|
| mRNA | mir430c-2-201 (1) | Ensembl | 73 nt | ||
| miRNA | mir430c-001 | 22 nt |
Transcripts related to mir430c-3
| Type | Name | Annotation Method | Has Havana Data | Length (nt) | Analysis |
|---|---|---|---|---|---|
| mRNA | mir430c-3-201 (1) | Ensembl | 73 nt | ||
| miRNA | mir430c-001 | 22 nt |
Transcripts related to mir430c-4
| Type | Name | Annotation Method | Has Havana Data | Length (nt) | Analysis |
|---|---|---|---|---|---|
| mRNA | mir430c-4-201 (1) | Ensembl | 73 nt | ||
| miRNA | mir430c-001 | 22 nt |
Transcripts related to mir430c-5
| Type | Name | Annotation Method | Has Havana Data | Length (nt) | Analysis |
|---|---|---|---|---|---|
| mRNA | mir430c-5-201 (1) | Ensembl | 73 nt | ||
| miRNA | mir430c-001 | 22 nt |
Transcripts related to mir430c-6
| Type | Name | Annotation Method | Has Havana Data | Length (nt) | Analysis |
|---|---|---|---|---|---|
| mRNA | mir430c-6-201 (1) | Ensembl | 73 nt | ||
| miRNA | mir430c-001 | 22 nt |
Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations