Genomic Feature
ug110
- ID
- ZDB-ALT-240313-5
- Name
- ug110
- Synonyms
- None
- Affected Genomic Region
- Construct
- None
- Type
- Allele with one deletion (1)
- Protocol
- embryos treated with
- Lab of Origin
- Marcos Gonzalez-Gaitán Laboratory
- Current Source
- Other Pages
-
Notes
| Comment | Citation |
|---|---|
|
PCR amplification using the following set of primers F: CACTTGCTGAGTAAGGCCCC, ... |
Zebrafish Nomenclature Committee |
Variants
- Variant Type
- Small Deletion
- Variant Location
- Chr: 3 Details
- Nucleotide Change
- Variant Notes
- None
Effect on DNA/cDNA, transcript, protein (from publications)
- DNA/cDNA Change
- 5 bp deleted (1)
- Transcript Consequence
- None
- Protein Consequence
- None
- Flanking Sequence
- None
- Additional Sequence
- None
Fish
Supplemental Information
- Genotyping protocol
- None