| ZFIN ID: ZDB-GENE-980526-221 |
| Gene Name: | desmin a |
|---|---|
| Symbol: | desma |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||||||
|
| Mapped Clones containing desma | |
|---|---|
| CH73-129N15 | Chr: 9 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | Citations |
|---|---|---|---|---|---|
| kg97 | 9 | 7,539,128 - 7,539,129 | GRCz11 | DIRECT | Kayman Kürekçi et al., 2021 |
| sa5 | 9 | 7,603,533 | GRCz12tu | DIRECT | Sealy et al., 2025 |
| 9 | 7,526,258 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | |
| 9 | 7,547,867 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | |
| 9 | 7,567,774 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | |
| sa15298 | 9 | 7,597,151 | GRCz12tu | DIRECT | Sealy et al., 2025 |
| 9 | 7,519,876 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | |
| 9 | 7,541,485 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | |
| 9 | 7,561,392 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | |
| sa34555 | 9 | 7,609,725 | GRCz12tu | DIRECT | Sealy et al., 2025 |
| 9 | 7,532,450 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | |
| 9 | 7,554,059 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | |
| 9 | 7,573,966 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | |
| umu10 | 9 | 7,539,233 - 7,539,241 | GRCz11 | DIRECT | Dennhag et al., 2024 |
| ct122aGt | 9 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| ct122aRGt | 9 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| kg97 | 9 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| umu10 | 9 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 9 | 47.1 cM | des | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 9 | 261.34 cR | desm | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 9 | 496.0 cR | desm | Goodfellow T51 (T51) | Geisler, Robert | Data |
| 9 | 25.8 cM | desmin | Heat Shock (HS) | Woods, Ian G. | Data |
| 9 | 25.53 cM | desm | Gates et al (GAT) | Talbot, William S. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Markers Encoded by desma | |||
|---|---|---|---|
| fb59a12 Chr: 9 Details | |||
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 180 | 36.0 | |
| Forward Primer | GCAGTGACCCATTACCGCAT | ||
| Reverse Primer | CAGATATGACCCAACCACAC |
| Genomic Feature ct122aGt is an allele of desma |