| ZFIN ID: ZDB-GENE-980526-531 |
| Gene Name: | retinoic acid receptor gamma a |
|---|---|
| Symbol: | rarga |
PHYSICAL MAP AND BROWSER
|
|
||||||||||||||||||||||||||||
|
| Mapped Clones containing rarga | |
|---|---|
| DKEY-148F24 | Chr: 23 Details |
| DKEY-43N10 | Chr: 23 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Source | Citations |
|---|---|---|---|---|---|
| sa32460 | 23 | 39,059,643 | GRCz12tu | DIRECT | Sealy et al., 2025 |
| 23 | 35,959,209 | GRCz11 | DIRECT | Busch-Nentwich et al., 2013 | |
| 23 | 35,860,406 | GRCz10 | DIRECT | Busch-Nentwich et al., 2013 | |
| 23 | 36,010,753 | Zv9 | DIRECT | Busch-Nentwich et al., 2013 | |
| la010912Tg | 23 | 35,992,769 - 35,992,779 | Zv9 | ZFIN_Zv9 | |
| la014420Tg | 23 | 35,950,008 - 35,950,018 | Zv9 | ZFIN_Zv9 | |
| la014421Tg | 23 | 35,993,591 - 35,993,601 | Zv9 | ZFIN_Zv9 | |
| la022698Tg | 23 | 35,977,271 - 35,977,281 | Zv9 | ZFIN_Zv9 | |
| la022699Tg | 23 | 35,993,556 - 35,993,566 | Zv9 | ZFIN_Zv9 | |
| la022701Tg | 23 | 35,997,974 - 35,997,984 | Zv9 | ZFIN_Zv9 | |
| la028558Tg | 23 | 35,982,564 - 35,982,574 | Zv9 | ZFIN_Zv9 | |
| la028559Tg | 23 | 36,002,569 - 36,002,579 | Zv9 | ZFIN_Zv9 | |
| la010912Tg | 23 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| la014420Tg | 23 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| la014421Tg | 23 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| la022698Tg | 23 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| la022699Tg | 23 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| la022701Tg | 23 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| la028558Tg | 23 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data | |
| la028559Tg | 23 | GRCz11 | OTHER_MAPPING | ZFIN Curated Data |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 23 | 125.1 cM | rarg | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 23 | 434.81 cR | rarg | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 23 | 5391.0 cR | rarg | Goodfellow T51 (T51) | Geisler, Robert | Data |
| 23 | 108.7 cM | rarg | Heat Shock (HS) | Woods, Ian G. | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Markers Encoded by rarga | |||
|---|---|---|---|
| fb01e02 Chr: 23 Details | |||
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 624 | 36.0 | |
| Forward Primer | GGGCCATAACTCTGAAGATG | ||
| Reverse Primer | GAACCCGTTGAAAGTACACTG |
| Genomic Feature la022699Tg is an allele of rarga |